- • Up to 20%-50%* off first purchase
- • Bulk quantities available
- • Citation Reward application
Sample Application
- • Animal health test
- • In-vitro diagnostics
- • Food & Feed Safety
- • Environmental Safety
- • New drug discovery
Supports
- Talk to our Expert:
[email protected] -
Talk to our sales:
[email protected]
Protocol Library Download
 |
 |
Human HTR1B/5-HT-1B/ 5-HT-1D-beta ORF/cDNA clone-Lentivirus plasmid (NM_000863)
Pre-made Human HTR1B/5-HT-1B/ 5-HT-1D-beta Lentiviral expression plasmid for HTR1B lentivirus packaging, HTR1B lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go
to HTR1B/5-HT-1B products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
| Catalog No. | Product Name | Plasmid Grade | Plasmid quantity |
|---|---|---|---|
| pGMLP002949 | Human HTR1B Lentivirus plasmid | Research Grade | 10mg, 50mg, 100mg, 500mg, >1g |
| GMP-like Grade | 10mg, 50mg, 100mg, 500mg, >1g | ||
| High Quality (HQ) Grade | |||
| Seed | 5ug |
Product Description
| Catalog ID | pGMLP002949 |
| Gene Name | HTR1B |
| Accession Number | NM_000863 |
| Gene ID | 3351 |
| Species | Human |
| Product Type | Lentivirus plasmid (overexpression) |
| Insert Length | 1173 bp |
| Gene Alias | 5-HT-1B, 5-HT-1D-beta, 5-HT1B, 5-HT1DB, HTR1D2, HTR1DB, S12 |
| Fluorescent Reporter | ZsGreen |
| Mammalian Cell Selection | Puromyocin |
| Fusion Tag | 3xflag (C-Terminal) |
| Promoter | CMV |
| Resistance | Amplicin |
| Sequence | ATGGAGGAACCGGGTGCTCAGTGCGCTCCACCGCCGCCCGCGGGCTCCGAGACCTGGGTTCCTCAAGCCAACTTATCCTCTGCTCCCTCCCAAAACTGCAGCGCCAAGGACTACATTTACCAGGACTCCATCTCCCTACCCTGGAAAGTACTGCTGGTTATGCTATTGGCGCTCATCACCTTGGCCACCACGCTCTCCAATGCCTTTGTGATTGCCACAGTGTACCGGACCCGGAAACTGCACACCCCGGCTAACTACCTGATCGCCTCTCTGGCGGTCACCGACCTGCTTGTGTCCATCCTGGTGATGCCCATCAGCACCATGTACACTGTCACCGGCCGCTGGACACTGGGCCAGGTGGTCTGTGACTTCTGGCTGTCGTCGGACATCACTTGTTGCACTGCCTCCATCCTGCACCTCTGTGTCATCGCCCTGGACCGCTACTGGGCCATCACGGACGCCGTGGAGTACTCAGCTAAAAGGACTCCCAAGAGGGCGGCGGTCATGATCGCGCTGGTGTGGGTCTTCTCCATCTCTATCTCGCTGCCGCCCTTCTTCTGGCGTCAGGCTAAGGCCGAAGAGGAGGTGTCGGAATGCGTGGTGAACACCGACCACATCCTCTACACGGTCTACTCCACGGTGGGTGCTTTCTACTTCCCCACCCTGCTCCTCATCGCCCTCTATGGCCGCATCTACGTAGAAGCCCGCTCCCGGATTTTGAAACAGACGCCCAACAGGACCGGCAAGCGCTTGACCCGAGCCCAGCTGATAACCGACTCCCCCGGGTCCACGTCCTCGGTCACCTCTATTAACTCGCGGGTTCCCGACGTGCCCAGCGAATCCGGATCTCCTGTGTATGTGAACCAAGTCAAAGTGCGAGTCTCCGACGCCCTGCTGGAAAAGAAGAAACTCATGGCCGCTAGGGAGCGCAAAGCCACCAAGACCCTAGGGATCATTTTGGGAGCCTTTATTGTGTGTTGGCTACCCTTCTTCATCATCTCCCTAGTGATGCCTATCTGCAAAGATGCCTGCTGGTTCCACCTAGCCATCTTTGACTTCTTCACATGGCTGGGCTATCTCAACTCCCTCATCAACCCCATAATCTATACCATGTCCAATGAGGACTTTAAACAAGCATTCCATAAACTGATACGTTTTAAGTGCACAAGTTGA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
| Category | Cat No. | Products Name |
|---|---|---|
| Target Antibody | GM-Tg-g-T07806-Ab | Anti-5HT1B/ HTR1B/ 5-HT-1B monoclonal antibody |
| Target Antigen | GM-Tg-g-T07806-Ag | HTR1B VLP (virus-like particle) |
| ORF Viral Vector | pGMLP002949 | Human HTR1B Lentivirus plasmid |
| ORF Viral Vector | vGMLP002949 | Human HTR1B Lentivirus particle |
Target information
| Target ID | GM-T07806 |
| Target Name | HTR1B |
| Gene ID | 3351, 15551, 716704, 25075, 100144391, 403741, 317707, 100009680 |
| Gene Symbol and Synonyms | 5-HT-1B,5-HT-1D-beta,5-HT1B,5-HT1DB,HTR1B,HTR1D2,HTR1DB,S12 |
| Uniprot Accession | P28222 |
| Uniprot Entry Name | 5HT1B_HUMAN |
| Protein Sub-location | Transmembrane Protein |
| Category | Therapeutics Target |
| Disease | Schizophrenia, Alcoholism and substance abuse |
| Gene Ensembl | ENSG00000135312 |
| Target Classification | GPCR |
The protein encoded by this intronless gene is a G-protein coupled receptor for serotonin (5-hydroxytryptamine). Ligand binding activates second messengers that inhibit the activity of adenylate cyclase and manage the release of serotonin, dopamine, and acetylcholine in the brain. The encoded protein may be involved in several neuropsychiatric disorders and therefore is often a target of antidepressant and other psychotherapeutic drugs. [provided by RefSeq, Nov 2015]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.
Facebook
LinkedIn
Twitter
