Human CD27/S152/S152. LPFS2 ORF/cDNA clone-Lentivirus plasmid (NM_001242)

Cat. No.: pGMLP002986
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human CD27/S152/S152. LPFS2 Lentiviral expression plasmid for CD27 lentivirus packaging, CD27 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.


Target products collection

Go to CD27/S152 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $495.75
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP002986
Gene Name CD27
Accession Number NM_001242
Gene ID 939
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 783 bp
Gene Alias S152,S152. LPFS2,T14,TNFRSF7,Tp55
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGCACGGCCACATCCCTGGTGGCTGTGCGTTCTGGGGACCCTGGTGGGGCTCTCAGCTACTCCAGCCCCCAAGAGCTGCCCAGAGAGGCACTACTGGGCTCAGGGAAAGCTGTGCTGCCAGATGTGTGAGCCAGGAACATTCCTCGTGAAGGACTGTGACCAGCATAGAAAGGCTGCTCAGTGTGATCCTTGCATACCGGGGGTCTCCTTCTCTCCTGACCACCACACCCGGCCCCACTGTGAGAGCTGTCGGCACTGTAACTCTGGTCTTCTCGTTCGCAACTGCACCATCACTGCCAATGCTGAGTGTGCCTGTCGCAATGGCTGGCAGTGCAGGGACAAGGAGTGCACCGAGTGTGATCCTCTTCCAAACCCTTCGCTGACCGCTCGGTCGTCTCAGGCCCTGAGCCCACACCCTCAGCCCACCCACTTACCTTATGTCAGTGAGATGCTGGAGGCCAGGACAGCTGGGCACATGCAGACTCTGGCTGACTTCAGGCAGCTGCCTGCCCGGACTCTCTCTACCCACTGGCCACCCCAAAGATCCCTGTGCAGCTCCGATTTTATTCGCATCCTTGTGATCTTCTCTGGAATGTTCCTTGTTTTCACCCTGGCCGGGGCCCTGTTCCTCCATCAACGAAGGAAATATAGATCAAACAAAGGAGAAAGTCCTGTGGAGCCTGCAGAGCCTTGTCATTACAGCTGCCCCAGGGAGGAGGAGGGCAGCACCATCCCCATCCAGGAGGATTACCGAAAACCGGAGCCTGCCTGCTCCCCCTGA
ORF Protein Sequence MARPHPWWLCVLGTLVGLSATPAPKSCPERHYWAQGKLCCQMCEPGTFLVKDCDQHRKAAQCDPCIPGVSFSPDHHTRPHCESCRHCNSGLLVRNCTITANAECACRNGWQCRDKECTECDPLPNPSLTARSSQALSPHPQPTHLPYVSEMLEARTAGHMQTLADFRQLPARTLSTHWPPQRSLCSSDFIRILVIFSGMFLVFTLAGALFLHQRRKYRSNKGESPVEPAEPCHYSCPREEEGSTIPIQEDYRKPEPACSP

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Biosimilar GMP-Bios-ab-614 Pre-Made Varlilumab biosimilar, Whole mAb, Anti-CD27 Antibody: Anti-T14/S152/Tp55/TNFRSF7/S152. LPFS2 therapeutic antibody
    Target Antibody GM-Tg-g-T85554-Ab Anti-CD27/ S152/ S152. LPFS2 monoclonal antibody
    Target Antigen GM-Tg-g-T85554-Ag CD27 VLP (virus-like particle)
    ORF Viral Vector pGMLP002986 Human CD27 Lentivirus plasmid
    ORF Viral Vector vGMLP002986 Human CD27 Lentivirus particle


    Target information

    Target ID GM-T85554
    Target Name CD27
    Gene ID 939, 21940, 500318, 101091633, 611674, 512514, 100630357
    Gene Symbol and Synonyms CD27,S152,S152. LPFS2,T14,TNFRSF7,Tp55
    Uniprot Accession P26842
    Uniprot Entry Name CD27_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target, Immuno-oncology Target, INN Index
    Disease Dent disease
    Gene Ensembl ENSG00000139193
    Target Classification Checkpoint-Immuno Oncology

    The protein encoded by this gene is a member of the TNF-receptor superfamily. This receptor is required for generation and long-term maintenance of T cell immunity. It binds to ligand CD70, and plays a key role in regulating B-cell activation and immunoglobulin synthesis. This receptor transduces signals that lead to the activation of NF-kappaB and MAPK8/JNK. Adaptor proteins TRAF2 and TRAF5 have been shown to mediate the signaling process of this receptor. CD27-binding protein (SIVA), a proapoptotic protein, can bind to this receptor and is thought to play an important role in the apoptosis induced by this receptor. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.