Human MEST/PEG1 ORF/cDNA clone-Lentivirus plasmid (NM_002402)

Cat. No.: pGMLP003018
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human MEST/PEG1 Lentiviral expression plasmid for MEST lentivirus packaging, MEST lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.


Target products collection

Go to MEST/PEG1 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $582.24
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP003018
Gene Name MEST
Accession Number NM_002402
Gene ID 4232
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 1008 bp
Gene Alias PEG1
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGTGCGCCGAGATCGCCTCCGCAGGATGAGGGAGTGGTGGGTCCAGGTGGGGCTGCTGGCCGTGCCCCTGCTTGCTGCGTACCTGCACATCCCACCCCCTCAGCTCTCCCCTGCCCTTCACTCATGGAAGTCTTCAGGCAAGTTTTTCACTTACAAGGGACTGCGTATCTTCTACCAAGACTCTGTGGGTGTGGTTGGAAGTCCAGAGATAGTTGTGCTTTTACACGGTTTTCCAACATCCAGCTACGACTGGTACAAGATTTGGGAAGGTCTGACCTTGAGGTTTCATCGGGTGATTGCCCTTGATTTCTTAGGCTTTGGCTTCAGTGACAAACCGAGACCACATCACTATTCCATATTTGAGCAGGCCAGCATCGTGGAAGCGCTTTTGCGGCATCTGGGGCTCCAGAACCGCAGGATCAACCTTCTTTCTCATGACTATGGAGATATTGTTGCTCAGGAGCTTCTCTACAGGTACAAGCAGAATCGATCTGGTCGGCTTACCATAAAGAGTCTCTGTCTGTCAAATGGAGGTATCTTTCCTGAGACTCACCGTCCACTCCTTCTCCAAAAGCTACTCAAAGATGGAGGTGTGCTGTCACCCATCCTCACACGACTGATGAACTTCTTTGTATTCTCTCGAGGTCTCACCCCAGTCTTTGGGCCGTATACTCGGCCCTCTGAGAGTGAGCTGTGGGACATGTGGGCAGGGATCCGCAACAATGACGGGAACTTAGTCATTGACAGTCTCTTACAGTACATCAATCAGAGGAAGAAGTTCAGAAGGCGCTGGGTGGGAGCTCTTGCCTCTGTAACTATCCCCATTCATTTTATCTATGGGCCATTGGATCCTGTAAATCCCTATCCAGAGTTTTTGGAGCTGTACAGGAAAACGCTGCCGCGGTCCACAGTGTCGATTCTGGATGACCACATTAGCCACTATCCACAGCTAGAGGATCCCATGGGCTTCTTGAATGCATATATGGGCTTCATCAACTCCTTCTGA
ORF Protein Sequence MVRRDRLRRMREWWVQVGLLAVPLLAAYLHIPPPQLSPALHSWKSSGKFFTYKGLRIFYQDSVGVVGSPEIVVLLHGFPTSSYDWYKIWEGLTLRFHRVIALDFLGFGFSDKPRPHHYSIFEQASIVEALLRHLGLQNRRINLLSHDYGDIVAQELLYRYKQNRSGRLTIKSLCLSNGGIFPETHRPLLLQKLLKDGGVLSPILTRLMNFFVFSRGLTPVFGPYTRPSESELWDMWAGIRNNDGNLVIDSLLQYINQRKKFRRRWVGALASVTIPIHFIYGPLDPVNPYPEFLELYRKTLPRSTVSILDDHISHYPQLEDPMGFLNAYMGFINSF

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE0338-Ab Anti-MEST/ PEG1 functional antibody
    Target Antigen GM-Tg-g-SE0338-Ag MEST protein
    ORF Viral Vector pGMLP003018 Human MEST Lentivirus plasmid
    ORF Viral Vector vGMLP003018 Human MEST Lentivirus particle


    Target information

    Target ID GM-SE0338
    Target Name MEST
    Gene ID 4232, 17294, 703327, 58827, 101091182, 607717, 404180, 100057213
    Gene Symbol and Synonyms MEST,PEG1
    Uniprot Accession Q5EB52
    Uniprot Entry Name MEST_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000106484
    Target Classification Not Available

    This gene encodes a member of the alpha/beta hydrolase superfamily. It is imprinted, exhibiting preferential expression from the paternal allele in fetal tissues, and isoform-specific imprinting in lymphocytes. The loss of imprinting of this gene has been linked to certain types of cancer and may be due to promotor switching. The encoded protein may play a role in development. Alternatively spliced transcript variants encoding multiple isoforms have been identified for this gene. Pseudogenes of this gene are located on the short arm of chromosomes 3 and 4, and the long arm of chromosomes 6 and 15. [provided by RefSeq, Dec 2011]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.