Human MEST/PEG1 ORF/cDNA clone-Lentivirus particle (NM_002402)
Cat. No.: vGMLP003018
Pre-made Human MEST/PEG1 Lentiviral expression plasmid for MEST lentivirus packaging, MEST lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go to
MEST/PEG1 products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
---|---|---|---|
vGMLP003018 | Human MEST Lentivirus particle | Pilot Grade | 1.0E+8TU |
5.0E+8TU | |||
1.0E+9TU | |||
Research Grade | 1.0E+8TU | ||
5.0E+8TU | |||
1.0E+9TU | |||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMLP003018 |
Gene Name | MEST |
Accession Number | NM_002402 |
Gene ID | 4232 |
Species | Human |
Product Type | Lentivirus particle (overexpression) |
Insert Length | 1008 bp |
Gene Alias | PEG1 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
ORF Nucleotide Sequence | ATGGTGCGCCGAGATCGCCTCCGCAGGATGAGGGAGTGGTGGGTCCAGGTGGGGCTGCTGGCCGTGCCCCTGCTTGCTGCGTACCTGCACATCCCACCCCCTCAGCTCTCCCCTGCCCTTCACTCATGGAAGTCTTCAGGCAAGTTTTTCACTTACAAGGGACTGCGTATCTTCTACCAAGACTCTGTGGGTGTGGTTGGAAGTCCAGAGATAGTTGTGCTTTTACACGGTTTTCCAACATCCAGCTACGACTGGTACAAGATTTGGGAAGGTCTGACCTTGAGGTTTCATCGGGTGATTGCCCTTGATTTCTTAGGCTTTGGCTTCAGTGACAAACCGAGACCACATCACTATTCCATATTTGAGCAGGCCAGCATCGTGGAAGCGCTTTTGCGGCATCTGGGGCTCCAGAACCGCAGGATCAACCTTCTTTCTCATGACTATGGAGATATTGTTGCTCAGGAGCTTCTCTACAGGTACAAGCAGAATCGATCTGGTCGGCTTACCATAAAGAGTCTCTGTCTGTCAAATGGAGGTATCTTTCCTGAGACTCACCGTCCACTCCTTCTCCAAAAGCTACTCAAAGATGGAGGTGTGCTGTCACCCATCCTCACACGACTGATGAACTTCTTTGTATTCTCTCGAGGTCTCACCCCAGTCTTTGGGCCGTATACTCGGCCCTCTGAGAGTGAGCTGTGGGACATGTGGGCAGGGATCCGCAACAATGACGGGAACTTAGTCATTGACAGTCTCTTACAGTACATCAATCAGAGGAAGAAGTTCAGAAGGCGCTGGGTGGGAGCTCTTGCCTCTGTAACTATCCCCATTCATTTTATCTATGGGCCATTGGATCCTGTAAATCCCTATCCAGAGTTTTTGGAGCTGTACAGGAAAACGCTGCCGCGGTCCACAGTGTCGATTCTGGATGACCACATTAGCCACTATCCACAGCTAGAGGATCCCATGGGCTTCTTGAATGCATATATGGGCTTCATCAACTCCTTCTGA |
ORF Protein Sequence | MVRRDRLRRMREWWVQVGLLAVPLLAAYLHIPPPQLSPALHSWKSSGKFFTYKGLRIFYQDSVGVVGSPEIVVLLHGFPTSSYDWYKIWEGLTLRFHRVIALDFLGFGFSDKPRPHHYSIFEQASIVEALLRHLGLQNRRINLLSHDYGDIVAQELLYRYKQNRSGRLTIKSLCLSNGGIFPETHRPLLLQKLLKDGGVLSPILTRLMNFFVFSRGLTPVFGPYTRPSESELWDMWAGIRNNDGNLVIDSLLQYINQRKKFRRRWVGALASVTIPIHFIYGPLDPVNPYPEFLELYRKTLPRSTVSILDDHISHYPQLEDPMGFLNAYMGFINSF |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-SE0338-Ab | Anti-MEST/ PEG1 functional antibody |
Target Antigen | GM-Tg-g-SE0338-Ag | MEST protein |
ORF Viral Vector | pGMLP003018 | Human MEST Lentivirus plasmid |
ORF Viral Vector | vGMLP003018 | Human MEST Lentivirus particle |
Target information
Target ID | GM-SE0338 |
Target Name | MEST |
Gene ID | 4232, 17294, 703327, 58827, 101091182, 607717, 404180, 100057213 |
Gene Symbol and Synonyms | MEST,PEG1 |
Uniprot Accession | Q5EB52 |
Uniprot Entry Name | MEST_HUMAN |
Protein Sub-location | Secreted Protein/Potential Cytokines |
Category | Not Available |
Disease | Not Available |
Gene Ensembl | ENSG00000106484 |
Target Classification | Not Available |
This gene encodes a member of the alpha/beta hydrolase superfamily. It is imprinted, exhibiting preferential expression from the paternal allele in fetal tissues, and isoform-specific imprinting in lymphocytes. The loss of imprinting of this gene has been linked to certain types of cancer and may be due to promotor switching. The encoded protein may play a role in development. Alternatively spliced transcript variants encoding multiple isoforms have been identified for this gene. Pseudogenes of this gene are located on the short arm of chromosomes 3 and 4, and the long arm of chromosomes 6 and 15. [provided by RefSeq, Dec 2011]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.