Human LPAR2/EDG-4/ EDG4 ORF/cDNA clone-Lentivirus plasmid (NM_004720)

Pre-made Human LPAR2/EDG-4/ EDG4 Lentiviral expression plasmid for LPAR2 lentivirus packaging, LPAR2 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

Target products collectionGo to LPAR2/EDG-4 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMLP003145 Human LPAR2 Lentivirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMLP003145
Gene Name LPAR2
Accession Number NM_004720
Gene ID 9170
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 1056 bp
Gene Alias EDG-4, EDG4, LPA-2, LPA2
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGGTCATCATGGGCCAGTGCTACTACAACGAGACCATCGGCTTCTTCTATAACAACAGTGGCAAAGAGCTCAGCTCCCACTGGCGGCCCAAGGATGTGGTCGTGGTGGCACTGGGGCTGACCGTCAGCGTGCTGGTGCTGCTGACCAATCTGCTGGTCATAGCAGCCATCGCCTCCAACCGCCGCTTCCACCAGCCCATCTACTACCTGCTCGGCAATCTGGCCGCGGCTGACCTCTTCGCGGGCGTGGCCTACCTCTTCCTCATGTTCCACACTGGTCCCCGCACAGCCCGACTTTCACTTGAGGGCTGGTTCCTGCGGCAGGGCTTGCTGGACACAAGCCTCACTGCGTCGGTGGCCACACTGCTGGCCATCGCCGTGGAGCGGCACCGCAGTGTGATGGCCGTGCAGCTGCACAGCCGCCTGCCCCGTGGCCGCGTGGTCATGCTCATTGTGGGCGTGTGGGTGGCTGCCCTGGGCCTGGGGCTGCTGCCTGCCCACTCCTGGCACTGCCTCTGTGCCCTGGACCGCTGCTCACGCATGGCACCCCTGCTCAGCCGCTCCTATTTGGCCGTCTGGGCTCTGTCGAGCCTGCTTGTCTTCCTGCTCATGGTGGCTGTGTACACCCGCATTTTCTTCTACGTGCGGCGGCGAGTGCAGCGCATGGCAGAGCATGTCAGCTGCCACCCCCGCTACCGAGAGACCACGCTCAGCCTGGTCAAGACTGTTGTCATCATCCTGGGGGCGTTCGTGGTCTGCTGGACACCAGGCCAGGTGGTACTGCTCCTGGATGGTTTAGGCTGTGAGTCCTGCAATGTCCTGGCTGTAGAAAAGTACTTCCTACTGTTGGCCGAGGCCAACTCACTGGTCAATGCTGCTGTGTACTCTTGCCGAGATGCTGAGATGCGCCGCACCTTCCGCCGCCTTCTCTGCTGCGCGTGCCTCCGCCAGTCCACCCGCGAGTCTGTCCACTATACATCCTCTGCCCAGGGAGGTGCCAGCACTCGCATCATGCTTCCCGAGAACGGCCACCCACTGATGGACTCCACCCTTTAG

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T39380-Ab Anti-LPAR2/ EDG-4/ EDG4 monoclonal antibody
    Target Antigen GM-Tg-g-T39380-Ag LPAR2 VLP (virus-like particle)
    ORF Viral Vector pGMLV000233 Human LPAR2 Lentivirus plasmid
    ORF Viral Vector pGMLP003145 Human LPAR2 Lentivirus plasmid
    ORF Viral Vector vGMLV000233 Human LPAR2 Lentivirus particle
    ORF Viral Vector vGMLP003145 Human LPAR2 Lentivirus particle


    Target information

    Target ID GM-T39380
    Target Name LPAR2
    Gene ID 9170, 53978, 719844, 498609, 101100950, 484802, 509748, 102147510
    Gene Symbol and Synonyms EDG-4,EDG4,IPA2,LPA-2,LPA2,LPAR2,PBX4,RGD1561336
    Uniprot Accession Q9HBW0
    Uniprot Entry Name LPAR2_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target
    Disease Not Available
    Gene Ensembl ENSG00000064547
    Target Classification GPCR

    This gene encodes a member of family I of the G protein-coupled receptors, as well as the EDG family of proteins. This protein functions as a lysophosphatidic acid (LPA) receptor and contributes to Ca2+ mobilization, a critical cellular response to LPA in cells, through association with Gi and Gq proteins. An alternative splice variant has been described but its full length sequence has not been determined. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.