Human LPAR2/EDG-4/EDG4 ORF/cDNA clone-Lentivirus particle (NM_004720)
Cat. No.: vGMLP003145
Pre-made Human LPAR2/EDG-4/EDG4 Lentiviral expression plasmid for LPAR2 lentivirus packaging, LPAR2 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go to
LPAR2/EDG-4 products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
| Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
|---|---|---|---|
| vGMLP003145 | Human LPAR2 Lentivirus particle | Pilot Grade | 1.0E+8TU |
| 5.0E+8TU | |||
| 1.0E+9TU | |||
| Research Grade | 1.0E+8TU | ||
| 5.0E+8TU | |||
| 1.0E+9TU | |||
| GMP-like Grade | inquiry | ||
| GMP Grade | inquiry |
Product Description
| Catalog ID | vGMLP003145 |
| Gene Name | LPAR2 |
| Accession Number | NM_004720 |
| Gene ID | 9170 |
| Species | Human |
| Product Type | Lentivirus particle (overexpression) |
| Insert Length | 1056 bp |
| Gene Alias | EDG-4,EDG4,LPA-2,LPA2 |
| Fluorescent Reporter | ZsGreen |
| Mammalian Cell Selection | Puromyocin |
| Fusion Tag | 3xflag (C-Terminal) |
| Promoter | CMV |
| Resistance | Amplicin |
| ORF Nucleotide Sequence | ATGGTCATCATGGGCCAGTGCTACTACAACGAGACCATCGGCTTCTTCTATAACAACAGTGGCAAAGAGCTCAGCTCCCACTGGCGGCCCAAGGATGTGGTCGTGGTGGCACTGGGGCTGACCGTCAGCGTGCTGGTGCTGCTGACCAATCTGCTGGTCATAGCAGCCATCGCCTCCAACCGCCGCTTCCACCAGCCCATCTACTACCTGCTCGGCAATCTGGCCGCGGCTGACCTCTTCGCGGGCGTGGCCTACCTCTTCCTCATGTTCCACACTGGTCCCCGCACAGCCCGACTTTCACTTGAGGGCTGGTTCCTGCGGCAGGGCTTGCTGGACACAAGCCTCACTGCGTCGGTGGCCACACTGCTGGCCATCGCCGTGGAGCGGCACCGCAGTGTGATGGCCGTGCAGCTGCACAGCCGCCTGCCCCGTGGCCGCGTGGTCATGCTCATTGTGGGCGTGTGGGTGGCTGCCCTGGGCCTGGGGCTGCTGCCTGCCCACTCCTGGCACTGCCTCTGTGCCCTGGACCGCTGCTCACGCATGGCACCCCTGCTCAGCCGCTCCTATTTGGCCGTCTGGGCTCTGTCGAGCCTGCTTGTCTTCCTGCTCATGGTGGCTGTGTACACCCGCATTTTCTTCTACGTGCGGCGGCGAGTGCAGCGCATGGCAGAGCATGTCAGCTGCCACCCCCGCTACCGAGAGACCACGCTCAGCCTGGTCAAGACTGTTGTCATCATCCTGGGGGCGTTCGTGGTCTGCTGGACACCAGGCCAGGTGGTACTGCTCCTGGATGGTTTAGGCTGTGAGTCCTGCAATGTCCTGGCTGTAGAAAAGTACTTCCTACTGTTGGCCGAGGCCAACTCCCTGGTCAATGCTGCTGTGTACTCTTGCCGAGATGCTGAGATGCGCCGCACCTTCCGCCGCCTTCTCTGCTGCGCGTGCCTCCGCCAGTCCACCCGCGAGTCTGTCCACTATACATCCTCTGCCCAGGGAGGTGCCAGCACTCGCATCATGCTTCCCGAGAACGGCCACCCACTGATGGACTCCACCCTTTAG |
| ORF Protein Sequence | MVIMGQCYYNETIGFFYNNSGKELSSHWRPKDVVVVALGLTVSVLVLLTNLLVIAAIASNRRFHQPIYYLLGNLAAADLFAGVAYLFLMFHTGPRTARLSLEGWFLRQGLLDTSLTASVATLLAIAVERHRSVMAVQLHSRLPRGRVVMLIVGVWVAALGLGLLPAHSWHCLCALDRCSRMAPLLSRSYLAVWALSSLLVFLLMVAVYTRIFFYVRRRVQRMAEHVSCHPRYRETTLSLVKTVVIILGAFVVCWTPGQVVLLLDGLGCESCNVLAVEKYFLLLAEANSLVNAAVYSCRDAEMRRTFRRLLCCACLRQSTRESVHYTSSAQGGASTRIMLPENGHPLMDSTL |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
| Category | Cat No. | Products Name |
|---|---|---|
| Target Antibody | GM-Tg-g-T39380-Ab | Anti-LPAR2/ EDG-4/ EDG4 monoclonal antibody |
| Target Antigen | GM-Tg-g-T39380-Ag | LPAR2 VLP (virus-like particle) |
| ORF Viral Vector | pGMLP003145 | Human LPAR2 Lentivirus plasmid |
| ORF Viral Vector | pGMLV000233 | Human LPAR2 Lentivirus plasmid |
| ORF Viral Vector | vGMLP003145 | Human LPAR2 Lentivirus particle |
| ORF Viral Vector | vGMLV000233 | Human LPAR2 Lentivirus particle |
Target information
| Target ID | GM-T39380 |
| Target Name | LPAR2 |
| Gene ID | 9170, 53978, 719844, 498609, 101100950, 484802, 509748, 102147510 |
| Gene Symbol and Synonyms | EDG-4,EDG4,IPA2,LPA-2,LPA2,LPAR2,PBX4,RGD1561336 |
| Uniprot Accession | Q9HBW0 |
| Uniprot Entry Name | LPAR2_HUMAN |
| Protein Sub-location | Transmembrane Protein |
| Category | Therapeutics Target |
| Disease | Not Available |
| Gene Ensembl | ENSG00000064547 |
| Target Classification | GPCR |
This gene encodes a member of family I of the G protein-coupled receptors, as well as the EDG family of proteins. This protein functions as a lysophosphatidic acid (LPA) receptor and contributes to Ca2+ mobilization, a critical cellular response to LPA in cells, through association with Gi and Gq proteins. An alternative splice variant has been described but its full length sequence has not been determined. [provided by RefSeq, Jul 2008]
About GMVC

GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.


