Human AQP8/AQP-8 ORF/cDNA clone-Lentivirus plasmid (NM_001169)

Cat. No.: pGMLP003173
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human AQP8/AQP-8 Lentiviral expression plasmid for AQP8 lentivirus packaging, AQP8 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

pdf Datasheet
pdf MSDS
pdf Terms of Use
Target products collection

Go to AQP8/AQP-8 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $496.5
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP003173
Gene Name AQP8
Accession Number NM_001169
Gene ID 343
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 786 bp
Gene Alias AQP-8
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGTCTGGAGAGATAGCCATGTGTGAGCCTGAATTTGGCAATGACAAGGCCAGGGAGCCGAGCGTGGGTGGCAGGTGGCGAGTGTCCTGGTACGAACGGTTTGTGCAGCCATGTCTGGTCGAACTGCTGGGCTCTGCTCTCTTCATCTTCATCGGGTGCCTGTCGGTCATTGAGAATGGGACGGACACTGGGCTGCTGCAGCCGGCCCTGGCCCACGGGCTGGCTTTGGGGCTCGTGATTGCCACGCTGGGGAATATCAGTGGTGGACACTTCAACCCTGCGGTGTCCCTGGCAGCCATGCTGATCGGAGGCCTCAACCTGGTGATGCTCCTCCCGTACTGGGTCTCACAGCTGCTCGGGGGGATGCTCGGGGCTGCCTTGGCCAAGGCGGTGAGTCCTGAGGAGAGGTTCTGGAATGCATCTGGGGCGGCCTTTGTGACAGTCCAGGAGCAGGGGCAGGTGGCAGGGGCGTTGGTGGCAGAGATCATCCTGACGACGCTGCTGGCCCTGGCTGTATGCATGGGTGCCATCAATGAGAAGACAAAGGGCCCTCTGGCCCCGTTCTCCATCGGCTTTGCCGTCACCGTGGATATCCTGGCTGGGGGCCCTGTGTCTGGAGGCTGCATGAATCCCGCCCGTGCTTTTGGACCTGCGGTGGTGGCCAACCACTGGAACTTCCACTGGATCTACTGGCTGGGCCCACTCCTGGCTGGCCTGCTTGTTGGACTGCTCATTAGGTGCTTCATTGGAGATGGGAAGACCCGCCTCATCCTGAAGGCTCGGTGA
ORF Protein Sequence MSGEIAMCEPEFGNDKAREPSVGGRWRVSWYERFVQPCLVELLGSALFIFIGCLSVIENGTDTGLLQPALAHGLALGLVIATLGNISGGHFNPAVSLAAMLIGGLNLVMLLPYWVSQLLGGMLGAALAKAVSPEERFWNASGAAFVTVQEQGQVAGALVAEIILTTLLALAVCMGAINEKTKGPLAPFSIGFAVTVDILAGGPVSGGCMNPARAFGPAVVANHWNFHWIYWLGPLLAGLLVGLLIRCFIGDGKTRLILKAR

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-MP0083-Ab Anti-AQP8/ AQP-8 monoclonal antibody
    Target Antigen GM-Tg-g-MP0083-Ag AQP8 VLP (virus-like particle)
    ORF Viral Vector pGMLP003173 Human AQP8 Lentivirus plasmid
    ORF Viral Vector pGMPC000030 Human AQP8 Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector vGMLP003173 Human AQP8 Lentivirus particle


    Target information

    Target ID GM-MP0083
    Target Name AQP8
    Gene ID 343, 11833, 702167, 29172, 101087700, 608036, 450206, 100061706
    Gene Symbol and Synonyms AQP-8,AQP8
    Uniprot Accession O94778
    Uniprot Entry Name AQP8_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000103375
    Target Classification Not Available

    Aquaporin 8 (AQP8) is a water channel protein. Aquaporins are a family of small integral membrane proteins related to the major intrinsic protein (MIP or AQP0).  Aquaporin 8 mRNA is found in pancreas and colon but not other tissues. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.