Human AQP8/AQP-8 ORF/cDNA clone-Mammalian (Non-Viral Vector) plasmid (NM_001169.2)

Cat. No.: pGMPC000030
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human AQP8/AQP-8 Non-Viral expression plasmid (overexpression vector) for mouse AQP8 overexpression in unique cell transient transfection and stable cell line development.

pdf Datasheet
pdf MSDS
pdf Terms of Use
Target products collection

Go to AQP8/AQP-8 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMPC000030
Gene Name AQP8
Accession Number NM_001169.2
Gene ID 343
Species Human
Product Type Mammalian (Non-Viral Vector) plasmid (overexpression)
Insert Length 786 bp
Gene Alias AQP-8
Fluorescent Reporter Null
Mammalian Cell Selection Null
Fusion Tag Null
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGTCTGGAGAGATAGCCATGTGTGAGCCTGAATTTGGCAATGACAAGGCCAGGGAGCCGAGCGTGGGTGGCAGGTGGCGAGTGTCCTGGTACGAACGGTTTGTGCAGCCATGTCTGGTCGAACTGCTGGGCTCTGCTCTCTTCATCTTCATCGGGTGCCTGTCGGTCATTGAGAATGGGACGGACACTGGGCTGCTGCAGCCGGCCCTGGCCCACGGGCTGGCTTTGGGGCTCGTGATTGCCACGCTGGGGAATATCAGTGGTGGACACTTCAACCCTGCGGTGTCCCTGGCAGCCATGCTGATCGGAGGCCTCAACCTGGTGATGCTCCTCCCGTACTGGGTCTCACAGCTGCTCGGGGGGATGCTCGGGGCTGCCTTGGCCAAGGCGGTGAGTCCTGAGGAGAGGTTCTGGAATGCATCTGGGGCGGCCTTTGTGACAGTCCAGGAGCAGGGGCAGGTGGCAGGGGCGTTGGTGGCAGAGATCATCCTGACGACGCTGCTGGCCCTGGCTGTATGCATGGGTGCCATCAATGAGAAGACAAAGGGCCCTCTGGCCCCGTTCTCCATCGGCTTTGCCGTCACCGTGGATATCCTGGCTGGGGGCCCTGTGTCTGGAGGCTGCATGAATCCCGCCCGTGCTTTTGGACCTGCGGTGGTGGCCAACCACTGGAACTTCCACTGGATCTACTGGCTGGGCCCACTCCTGGCTGGCCTGCTTGTTGGACTGCTCATTAGGTGCTTCATTGGAGATGGGAAGACCCGCCTCATCCTGAAGGCTCGGTGA
ORF Protein Sequence MSGEIAMCEPEFGNDKAREPSVGGRWRVSWYERFVQPCLVELLGSALFIFIGCLSVIENGTDTGLLQPALAHGLALGLVIATLGNISGGHFNPAVSLAAMLIGGLNLVMLLPYWVSQLLGGMLGAALAKAVSPEERFWNASGAAFVTVQEQGQVAGALVAEIILTTLLALAVCMGAINEKTKGPLAPFSIGFAVTVDILAGGPVSGGCMNPARAFGPAVVANHWNFHWIYWLGPLLAGLLVGLLIRCFIGDGKTRLILKAR

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-MP0083-Ab Anti-AQP8/ AQP-8 monoclonal antibody
    Target Antigen GM-Tg-g-MP0083-Ag AQP8 VLP (virus-like particle)
    ORF Viral Vector pGMLP003173 Human AQP8 Lentivirus plasmid
    ORF Viral Vector pGMPC000030 Human AQP8 Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector vGMLP003173 Human AQP8 Lentivirus particle


    Target information

    Target ID GM-MP0083
    Target Name AQP8
    Gene ID 343, 11833, 702167, 29172, 101087700, 608036, 450206, 100061706
    Gene Symbol and Synonyms AQP-8,AQP8
    Uniprot Accession O94778
    Uniprot Entry Name AQP8_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000103375
    Target Classification Not Available

    Aquaporin 8 (AQP8) is a water channel protein. Aquaporins are a family of small integral membrane proteins related to the major intrinsic protein (MIP or AQP0).  Aquaporin 8 mRNA is found in pancreas and colon but not other tissues. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.