Human GPM6B/M6B ORF/cDNA clone-Lentivirus plasmid (NM_001001996)

Cat. No.: pGMLP003241
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human GPM6B/M6B Lentiviral expression plasmid for GPM6B lentivirus packaging, GPM6B lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

pdf Datasheet
pdf MSDS
pdf Terms of Use
Target products collection

Go to GPM6B/M6B products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $529.5
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP003241
Gene Name GPM6B
Accession Number NM_001001996
Gene ID 2824
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 918 bp
Gene Alias M6B
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGAAGCCAGCCATGGAAACTGCAGCCGAGGAAAATACTGAACAAAGCCAAGAGAGAAAAGTGAACAGCAGAGCTGAAATGGAAATTGGCAGGTACCACTGGATGTACCCAGGCTCAAAGAACCACCAGTACCATCCCGTGCCAACCCTGGGGGACAGGGCTAGCCCCTTGAGCAGTCCAGGCTGCTTTGAATGCTGCATCAAGTGTCTGGGAGGAGTCCCCTACGCCTCCCTGGTGGCCACCATCCTCTGCTTCTCCGGGGTGGCCTTATTCTGCGGCTGTGGGCATGTGGCTCTCGCAGGCACCGTGGCGATTCTTGAGCAACACTTCTCCACCAACGCCAGTGACCATGCCTTGCTGAGCGAGGTGATACAACTGATGCAGTATGTCATCTATGGAATTGCGTCCTTTTTCTTCTTGTATGGGATCATTCTGTTGGCAGAAGGCTTTTACACCACAAGTGCAGTGAAAGAACTGCACGGTGAGTTTAAAACAACCGCTTGTGGCCGATGCATCAGTGGAATGTTCGTTTTCCTCACCTATGTGCTTGGAGTGGCCTGGCTGGGTGTGTTTGGTTTCTCAGCGGTGCCCGTGTTTATGTTCTACAACATATGGTCAACTTGTGAAGTCATCAAGTCACCGCAGACCAACGGGACCACGGGTGTGGAGCAGATCTGTGTGGATATCCGACAATACGGTATCATTCCTTGGAATGCTTTCCCCGGAAAAATATGTGGCTCTGCCCTGGAGAACATCTGCAACACAAACGAGTTCTACATGTCCTATCACCTGTTCATTGTGGCCTGTGCAGGAGCTGGTGCCACCGTCATTGCCCTGCTGATCTACATGATGGCTACTACATATAACTATGCGGTTTTGAAGTTTAAGAGTCGGGAAGATTGCTGCACTAAATTCTAA
ORF Protein Sequence MKPAMETAAEENTEQSQERKVNSRAEMEIGRYHWMYPGSKNHQYHPVPTLGDRASPLSSPGCFECCIKCLGGVPYASLVATILCFSGVALFCGCGHVALAGTVAILEQHFSTNASDHALLSEVIQLMQYVIYGIASFFFLYGIILLAEGFYTTSAVKELHGEFKTTACGRCISGMFVFLTYVLGVAWLGVFGFSAVPVFMFYNIWSTCEVIKSPQTNGTTGVEQICVDIRQYGIIPWNAFPGKICGSALENICNTNEFYMSYHLFIVACAGAGATVIALLIYMMATTYNYAVLKFKSREDCCTKF

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-MP0497-Ab Anti-GPM6B/ M6B monoclonal antibody
    Target Antigen GM-Tg-g-MP0497-Ag GPM6B VLP (virus-like particle)
    ORF Viral Vector pGMLP003241 Human GPM6B Lentivirus plasmid
    ORF Viral Vector vGMLP003241 Human GPM6B Lentivirus particle


    Target information

    Target ID GM-MP0497
    Target Name GPM6B
    Gene ID 2824, 14758, 711762, 192179, 101089746, 480842, 516689, 100050640
    Gene Symbol and Synonyms Gpm6,GPM6B,M6B
    Uniprot Accession Q13491
    Uniprot Entry Name GPM6B_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Not Available
    Disease Ovary Cancer
    Gene Ensembl ENSG00000046653
    Target Classification Not Available

    This gene encodes a membrane glycoprotein that belongs to the proteolipid protein family. Proteolipid protein family members are expressed in most brain regions and are thought to be involved in cellular housekeeping functions such as membrane trafficking and cell-to-cell communication. This protein may also be involved in osteoblast differentiation. Alternate splicing results in multiple transcript variants. Pseudogenes of this gene are located on chromosomes Y and 22. [provided by RefSeq, Jan 2016]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.