Human VKORC1/EDTP308/ MST134 ORF/cDNA clone-Lentivirus plasmid (NM_024006)

Pre-made Human VKORC1/EDTP308/ MST134 Lentiviral expression plasmid for VKORC1 lentivirus packaging, VKORC1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

Target products collectionGo to VKORC1/EDTP308 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMLP003324 Human VKORC1 Lentivirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMLP003324
Gene Name VKORC1
Accession Number NM_024006
Gene ID 79001
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 492 bp
Gene Alias EDTP308, MST134, MST576, VKCFD2, VKOR
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGGGCAGCACCTGGGGGAGCCCTGGCTGGGTGCGGCTCGCTCTTTGCCTGACGGGCTTAGTGCTCTCGCTCTACGCGCTGCACGTGAAGGCGGCGCGCGCCCGGGACCGGGATTACCGCGCGCTCTGCGACGTGGGCACCGCCATCAGCTGTTCGCGCGTCTTCTCCTCCAGGTGGGGCAGGGGTTTCGGGCTGGTGGAGCATGTGCTGGGACAGGACAGCATCCTCAATCAATCCAACAGCATATTCGGTTGCATCTTCTACACACTACAGCTATTGTTAGGTTGCCTGCGGACACGCTGGGCCTCTGTCCTGATGCTGCTGAGCTCCCTGGTGTCTCTCGCTGGTTCTGTCTACCTGGCCTGGATCCTGTTCTTCGTGCTCTATGATTTCTGCATTGTTTGTATCACCACCTATGCTATCAACGTGAGCCTGATGTGGCTCAGTTTCCGGAAGGTCCAAGAACCCCAGGGCAAGGCTAAGAGGCACTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T11843-Ab Anti-VKOR1/ VKORC1/ EDTP308 functional antibody
    Target Antigen GM-Tg-g-T11843-Ag VKORC1 protein
    ORF Viral Vector pGMLP003324 Human VKORC1 Lentivirus plasmid
    ORF Viral Vector vGMLP003324 Human VKORC1 Lentivirus particle


    Target information

    Target ID GM-T11843
    Target Name VKORC1
    Gene ID 79001, 27973, 714412, 309004, 101089669, 479775, 445422, 100063360
    Gene Symbol and Synonyms D7Wsu86e,EDTP308,MST134,MST576,VKCFD2,VKOR,VKORC1
    Uniprot Accession Q9BQB6
    Uniprot Entry Name VKOR1_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Therapeutics Target
    Disease Not Available
    Gene Ensembl ENSG00000167397
    Target Classification Not Available

    This gene encodes the catalytic subunit of the vitamin K epoxide reductase complex, which is responsible for the reduction of inactive vitamin K 2,3-epoxide to active vitamin K in the endoplasmic reticulum membrane. Vitamin K is a required co-factor for carboxylation of glutamic acid residues by vitamin K-dependent gamma-carboxylase in blood-clotting enzymes. Allelic variation in this gene is associated with vitamin k-dependent clotting factors combined deficiency of 2, and increased resistance or sensitivity to warfarin, an inhibitor of vitamin K epoxide reductase. Pseudogenes of this gene are located on chromosomes 1 and X. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2015]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.