- • Up to 20%-50%* off first purchase
- • Bulk quantities available
- • Citation Reward application
Sample Application
- • Animal health test
- • In-vitro diagnostics
- • Food & Feed Safety
- • Environmental Safety
- • New drug discovery
Supports
- Talk to our Expert:
[email protected] -
Talk to our sales:
[email protected]
Protocol Library Download
 |
 |
Human PDHA1/PDHA/ PDHAD ORF/cDNA clone-Lentivirus plasmid (NM_000284)
Pre-made Human PDHA1/PDHA/ PDHAD Lentiviral expression plasmid for PDHA1 lentivirus packaging, PDHA1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go
to PDHA1/PDHA products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
| Catalog No. | Product Name | Plasmid Grade | Plasmid quantity |
|---|---|---|---|
| pGMLP003325 | Human PDHA1 Lentivirus plasmid | Research Grade | 10mg, 50mg, 100mg, 500mg, >1g |
| GMP-like Grade | 10mg, 50mg, 100mg, 500mg, >1g | ||
| High Quality (HQ) Grade | |||
| Seed | 5ug |
Product Description
| Catalog ID | pGMLP003325 |
| Gene Name | PDHA1 |
| Accession Number | NM_000284 |
| Gene ID | 5160 |
| Species | Human |
| Product Type | Lentivirus plasmid (overexpression) |
| Insert Length | 1173 bp |
| Gene Alias | PDHA, PDHAD, PDHCE1A, PHE1A |
| Fluorescent Reporter | ZsGreen |
| Mammalian Cell Selection | Puromyocin |
| Fusion Tag | 3xflag (C-Terminal) |
| Promoter | CMV |
| Resistance | Amplicin |
| Sequence | ATGAGGAAGATGCTCGCCGCCGTCTCCCGCGTGCTGTCTGGCGCTTCTCAGAAGCCGGCAAGCAGAGTGCTGGTAGCATCCCGTAATTTTGCAAATGATGCTACATTTGAAATTAAGAAATGTGACCTTCACCGGCTGGAAGAAGGCCCTCCTGTCACAACAGTGCTCACCAGGGAGGATGGGCTCAAATACTACAGGATGATGCAGACTGTACGCCGAATGGAGTTGAAAGCAGATCAGCTGTATAAACAGAAAATTATTCGTGGTTTCTGTCACTTGTGTGATGGTCAGGAAGCTTGCTGTGTGGGCCTGGAGGCCGGCATCAACCCCACAGACCATCTCATCACAGCCTACCGGGCTCACGGCTTTACTTTCACCCGGGGCCTTTCCGTCCGAGAAATTCTCGCAGAGCTTACAGGACGAAAAGGAGGTTGTGCTAAAGGGAAAGGAGGATCGATGCACATGTATGCCAAGAACTTCTACGGGGGCAATGGCATCGTGGGAGCGCAGGTGCCCCTGGGCGCTGGGATTGCTCTAGCCTGTAAGTATAATGGAAAAGATGAGGTCTGCCTGACTTTATATGGCGATGGTGCTGCTAACCAGGGCCAGATATTCGAAGCTTACAACATGGCAGCTTTGTGGAAATTACCTTGTATTTTCATCTGTGAGAATAATCGCTATGGAATGGGAACGTCTGTTGAGAGAGCGGCAGCCAGCACTGATTACTACAAGAGAGGCGATTTCATTCCTGGGCTGAGAGTGGATGGAATGGATATCCTGTGCGTCCGAGAGGCAACAAGGTTTGCTGCTGCCTATTGTAGATCTGGGAAGGGGCCCATCCTGATGGAGCTGCAGACTTACCGTTACCACGGACACAGTATGAGTGACCCTGGAGTCAGTTACCGTACACGAGAAGAAATTCAGGAAGTAAGAAGTAAGAGTGACCCTATTATGCTTCTCAAGGACAGGATGGTGAACAGCAATCTTGCCAGTGTGGAAGAACTAAAGGAAATTGATGTGGAAGTGAGGAAGGAGATTGAGGATGCTGCCCAGTTTGCCACGGCCGATCCTGAGCCACCTTTGGAAGAGCTGGGCTACCACATCTACTCCAGCGACCCACCTTTTGAAGTTCGTGGTGCCAATCAGTGGATCAAGTTTAAGTCAGTCAGTTAA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
| Category | Cat No. | Products Name |
|---|---|---|
| Target Antibody | GM-Tg-g-SE1495-Ab | Anti-ODPA/ PDHA1/ PDHA functional antibody |
| Target Antigen | GM-Tg-g-SE1495-Ag | PDHA1 protein |
| ORF Viral Vector | pGMAD000702 | Human PDHA1 Adenovirus plasmid |
| ORF Viral Vector | pGMAD000924 | Human PDHA1 Adenovirus plasmid |
| ORF Viral Vector | pGMLP003325 | Human PDHA1 Lentivirus plasmid |
| ORF Viral Vector | vGMAD000702 | Human PDHA1 Adenovirus particle |
| ORF Viral Vector | vGMAD000924 | Human PDHA1 Adenovirus particle |
| ORF Viral Vector | vGMLP003325 | Human PDHA1 Lentivirus particle |
Target information
| Target ID | GM-SE1495 |
| Target Name | PDHA1 |
| Gene ID | 5160, 18597, 100423990, 29554, 101080765, 119868382, 407109, 100051597 |
| Gene Symbol and Synonyms | E1alpha,PDHA,Pdha-1,PDHA1,PDHAD,PDHCE1A,PHE1A |
| Uniprot Accession | P08559 |
| Uniprot Entry Name | ODPA_HUMAN |
| Protein Sub-location | Secreted Protein/Potential Cytokines |
| Category | Not Available |
| Disease | Not Available |
| Gene Ensembl | ENSG00000131828 |
| Target Classification | Not Available |
The pyruvate dehydrogenase (PDH) complex is a nuclear-encoded mitochondrial multienzyme complex that catalyzes the overall conversion of pyruvate to acetyl-CoA and CO(2), and provides the primary link between glycolysis and the tricarboxylic acid (TCA) cycle. The PDH complex is composed of multiple copies of three enzymatic components: pyruvate dehydrogenase (E1), dihydrolipoamide acetyltransferase (E2) and lipoamide dehydrogenase (E3). The E1 enzyme is a heterotetramer of two alpha and two beta subunits. This gene encodes the E1 alpha 1 subunit containing the E1 active site, and plays a key role in the function of the PDH complex. Mutations in this gene are associated with pyruvate dehydrogenase E1-alpha deficiency and X-linked Leigh syndrome. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Mar 2010]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.
Facebook
LinkedIn
Twitter
