Human ASIC1/ACCN2/ ASIC ORF/cDNA clone-Lentivirus plasmid (NM_001095)

Pre-made Human ASIC1/ACCN2/ ASIC Lentiviral expression plasmid for ASIC1 lentivirus packaging, ASIC1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

Target products collectionGo to ASIC1/ACCN2 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMLP003358 Human ASIC1 Lentivirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMLP003358
Gene Name ASIC1
Accession Number NM_001095
Gene ID 41
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 1587 bp
Gene Alias ACCN2, ASIC, BNaC2
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGGAACTGAAGGCCGAGGAGGAGGAGGTGGGTGGCGTCCAGCCGGTGAGCATCCAGGCCTTCGCCAGCAGCTCCACACTGCACGGCCTGGCCCACATCTTCTCCTACGAGCGGCTGTCTCTGAAGCGGGCACTGTGGGCCCTGTGCTTCCTGGGCTCGCTGGCTGTGCTGCTGTGTGTGTGCACGGAGCGTGTGCAGTACTACTTCCACTACCACCATGTCACCAAGCTCGACGAGGTGGCTGCCTCTCAGCTTACCTTCCCTGCTGTCACGCTGTGCAACCTCAACGAGTTCCGCTTTAGCCAAGTCTCCAAGAATGACCTGTATCATGCTGGGGAGCTGCTGGCCCTGCTCAACAACAGGTATGAGATACCAGACACACAGATGGCAGATGAAAAGCAGCTGGAGATACTGCAGGACAAAGCCAACTTCCGCAGCTTCAAACCCAAACCCTTCAACATGCGTGAGTTCTACGACCGAGCTGGGCACGACATTCGAGACATGCTGCTCTCCTGCCACTTCCGGGGGGAGGTCTGCAGCGCTGAAGACTTCAAGGTGGTCTTCACACGCTATGGAAAGTGCTACACGTTCAACTCGGGCCGAGATGGGCGGCCGCGGCTGAAGACCATGAAGGGTGGGACGGGCAATGGGCTGGAAATCATGCTGGACATCCAGCAGGACGAGTACCTGCCTGTGTGGGGGGAGACTGACGAGACGTCCTTCGAAGCAGGCATCAAAGTGCAGATCCATAGTCAGGATGAACCTCCTTTCATCGACCAGCTGGGCTTTGGCGTGGCCCCAGGCTTCCAGACCTTTGTGGCCTGCCAGGAGCAGCGGCTCATCTACCTGCCCCCACCCTGGGGCACCTGCAAAGCTGTTACCATGGACTCGGATTTGGATTTCTTCGACTCCTACAGCATCACTGCCTGCCGCATCGACTGTGAGACGCGCTACCTGGTGGAGAACTGCAACTGCCGCATGGTGCACATGCCAGGGGATGCCCCATACTGTACTCCAGAGCAGTACAAGGAGTGTGCAGATCCTGCTCTGGACTTCCTGGTGGAGAAGGACCAGGAGTACTGCGTGTGTGAAATGCCTTGCAACCTGACCCGCTATGGCAAAGAGCTGTCCATGGTCAAGATCCCCAGCAAAGCCTCAGCCAAGTACCTGGCCAAGAAGTTCAACAAATCTGAGCAATACATAGGGGAGAACATCCTGGTGCTGGACATTTTCTTTGAAGTCCTCAACTATGAGACCATTGAACAGAAGAAGGCCTATGAGATTGCAGGGCTCCTGGGTGACATCGGGGGCCAGATGGGGCTGTTCATCGGGGCCAGCATCCTCACGGTGCTGGAGCTCTTTGACTACGCCTACGAGGTCATTAAGCACAAGCTGTGCCGACGAGGAAAATGCCAGAAGGAGGCCAAAAGGAGCAGTGCGGACAAGGGCGTGGCCCTCAGCCTGGACGACGTCAAAAGACACAACCCGTGCGAGAGCCTTCGGGGCCACCCTGCCGGGATGACATACGCTGCCAACATCCTACCTCACCATCCGGCCCGAGGCACGTTCGAGGACTTTACCTGCTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T55094-Ab Anti-ASIC1/ ACCN2/ ASIC monoclonal antibody
    Target Antigen GM-Tg-g-T55094-Ag ASIC1 VLP (virus-like particle)
    ORF Viral Vector pGMLV000085 Human ASIC1 Lentivirus plasmid
    ORF Viral Vector pGMPC000055 Rat Asic1 Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector pGMLP003358 Human ASIC1 Lentivirus plasmid
    ORF Viral Vector vGMLV000085 Human ASIC1 Lentivirus particle
    ORF Viral Vector vGMLP003358 Human ASIC1 Lentivirus particle
    ORF Viral Vector pGMLV002484 Human ASIC1 Lentivirus plasmid


    Target information

    Target ID GM-T55094
    Target Name ASIC1
    Gene ID 41, 11419, 713320, 79123, 101085729, 477612, 538244, 100630368
    Gene Symbol and Synonyms ACCN2,ASIC,ASIC1,ASIC1a,ASIC1b,B530003N02Rik,BNaC2
    Uniprot Accession P78348
    Uniprot Entry Name ASIC1_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target
    Disease Not Available
    Gene Ensembl ENSG00000110881
    Target Classification Not Available

    This gene encodes a member of the acid-sensing ion channel (ASIC) family of proteins, which are part of the degenerin/epithelial sodium channel (DEG/ENaC) superfamily. Members of the ASIC family are sensitive to amiloride and function in neurotransmission. The encoded proteins function in learning, pain transduction, touch sensation, and development of memory and fear. Alternatively spliced transcript variants have been described. [provided by RefSeq, Feb 2012]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.