Human CCL3/G0S19-1/ LD78ALPHA ORF/cDNA clone-Lentivirus plasmid (NM_002983)
Pre-made Human CCL3/G0S19-1/ LD78ALPHA Lentiviral expression plasmid for CCL3 lentivirus packaging, CCL3 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go
to CCL3/G0S19-1 products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Plasmid Grade | Plasmid quantity |
---|---|---|---|
pGMLP003374 | Human CCL3 Lentivirus plasmid | Research Grade | 10mg, 50mg, 100mg, 500mg, >1g |
GMP-like Grade | 10mg, 50mg, 100mg, 500mg, >1g | ||
High Quality (HQ) Grade | |||
Seed | 5ug |
Product Description
Catalog ID | pGMLP003374 |
Gene Name | CCL3 |
Accession Number | NM_002983 |
Gene ID | 6348 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 279 bp |
Gene Alias | G0S19-1, LD78ALPHA, MIP-1-alpha, MIP1A, SCYA3 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGCAGGTCTCCACTGCTGCCCTTGCTGTCCTCCTCTGCACCATGGCTCTCTGCAACCAGTTCTCTGCATCACTTGCTGCTGACACGCCGACCGCCTGCTGCTTCAGCTACACCTCCCGGCAGATTCCACAGAATTTCATAGCTGACTACTTTGAGACGAGCAGCCAGTGCTCCAAGCCCGGTGTCATCTTCCTAACCAAGCGAAGCCGGCAGGTCTGTGCTGACCCCAGTGAGGAGTGGGTCCAGAAATATGTCAGCGACCTGGAGCTGAGTGCCTGA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T97765-Ab | Anti-CCL3/ G0S19-1/ LD78ALPHA functional antibody |
Target Antigen | GM-Tg-g-T97765-Ag | CCL3 protein |
Cytokine | cks-Tg-g-GM-T97765 | chemokine (C-C motif) ligand 3 (CCL3) protein & antibody |
ORF Viral Vector | pGMLP003374 | Human CCL3 Lentivirus plasmid |
ORF Viral Vector | vGMLP003374 | Human CCL3 Lentivirus particle |
Target information
Target ID | GM-T97765 |
Target Name | CCL3 |
Gene ID | 6348 |
Gene Symbol and Synonyms | CCL3,G0S19-1,LD78ALPHA,MIP-1-alpha,MIP1A,SCYA3 |
Uniprot Accession | P10147 |
Uniprot Entry Name | CCL3_HUMAN |
Protein Sub-location | Secreted Protein/Potential Cytokines |
Category | Therapeutics Target, Cytokine Target |
Disease | Cancer |
Gene Ensembl | ENSG00000277632 |
Target Classification | Tumor-associated antigen (TAA) |
This locus represents a small inducible cytokine. The encoded protein, also known as macrophage inflammatory protein 1 alpha, plays a role in inflammatory responses through binding to the receptors CCR1, CCR4 and CCR5. Polymorphisms at this locus may be associated with both resistance and susceptibility to infection by human immunodeficiency virus type 1.[provided by RefSeq, Sep 2010]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.