Human CCL3/G0S19-1/ LD78ALPHA ORF/cDNA clone-Lentivirus particle (NM_002983)

Pre-made Human CCL3/G0S19-1/ LD78ALPHA Lentiviral expression plasmid for CCL3 lentivirus packaging, CCL3 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collectionGo to CCL3/G0S19-1 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP003374 Human CCL3 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP003374
Gene Name CCL3
Accession Number NM_002983
Gene ID 6348
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 279 bp
Gene Alias G0S19-1, LD78ALPHA, MIP-1-alpha, MIP1A, SCYA3
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGCAGGTCTCCACTGCTGCCCTTGCTGTCCTCCTCTGCACCATGGCTCTCTGCAACCAGTTCTCTGCATCACTTGCTGCTGACACGCCGACCGCCTGCTGCTTCAGCTACACCTCCCGGCAGATTCCACAGAATTTCATAGCTGACTACTTTGAGACGAGCAGCCAGTGCTCCAAGCCCGGTGTCATCTTCCTAACCAAGCGAAGCCGGCAGGTCTGTGCTGACCCCAGTGAGGAGTGGGTCCAGAAATATGTCAGCGACCTGGAGCTGAGTGCCTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T97765-Ab Anti-CCL3/ G0S19-1/ LD78ALPHA functional antibody
    Target Antigen GM-Tg-g-T97765-Ag CCL3 protein
    Cytokine cks-Tg-g-GM-T97765 chemokine (C-C motif) ligand 3 (CCL3) protein & antibody
    ORF Viral Vector pGMLP003374 Human CCL3 Lentivirus plasmid
    ORF Viral Vector vGMLP003374 Human CCL3 Lentivirus particle


    Target information

    Target ID GM-T97765
    Target Name CCL3
    Gene ID 6348
    Gene Symbol and Synonyms CCL3,G0S19-1,LD78ALPHA,MIP-1-alpha,MIP1A,SCYA3
    Uniprot Accession P10147
    Uniprot Entry Name CCL3_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Therapeutics Target, Cytokine Target
    Disease Cancer
    Gene Ensembl ENSG00000277632
    Target Classification Tumor-associated antigen (TAA)

    This locus represents a small inducible cytokine. The encoded protein, also known as macrophage inflammatory protein 1 alpha, plays a role in inflammatory responses through binding to the receptors CCR1, CCR4 and CCR5. Polymorphisms at this locus may be associated with both resistance and susceptibility to infection by human immunodeficiency virus type 1.[provided by RefSeq, Sep 2010]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.