Human IL17D/IL-17D ORF/cDNA clone-Lentivirus plasmid (NM_138284)
Pre-made Human IL17D/IL-17D Lentiviral expression plasmid for IL17D lentivirus packaging, IL17D lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go
to IL27/IL17D/IL-17D products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Plasmid Grade | Plasmid quantity |
---|---|---|---|
pGMLP003442 | Human IL17D Lentivirus plasmid | Research Grade | 10mg, 50mg, 100mg, 500mg, >1g |
GMP-like Grade | 10mg, 50mg, 100mg, 500mg, >1g | ||
High Quality (HQ) Grade | |||
Seed | 5ug |
Product Description
Catalog ID | pGMLP003442 |
Gene Name | IL17D |
Accession Number | NM_138284 |
Gene ID | 53342 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 609 bp |
Gene Alias | IL-17D |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGCTGGTAGCCGGCTTCCTGCTGGCGCTGCCGCCGAGCTGGGCCGCGGGCGCCCCGAGGGCGGGCAGGCGCCCCGCGCGGCCGCGGGGCTGCGCGGACCGGCCGGAGGAGCTACTGGAGCAGCTGTACGGGCGCCTGGCGGCCGGCGTGCTCAGTGCCTTCCACCACACGCTGCAGCTGGGGCCGCGTGAGCAGGCGCGCAACGCGAGCTGCCCGGCAGGGGGCAGGCCCGCCGACCGCCGCTTCCGGCCGCCCACCAACCTGCGCAGCGTGTCGCCCTGGGCCTACAGAATCTCCTACGACCCGGCGAGGTACCCCAGGTACCTGCCTGAAGCCTACTGCCTGTGCCGGGGCTGCCTGACCGGGCTGTTCGGCGAGGAGGACGTGCGCTTCCGCAGCGCCCCTGTCTACATGCCCACCGTCGTCCTGCGCCGCACCCCCGCCTGCGCCGGCGGCCGTTCCGTCTACACCGAGGCCTACGTCACCATCCCCGTGGGCTGCACCTGCGTCCCCGAGCCGGAGAAGGACGCAGACAGCATCAACTCCAGCATCGACAAACAGGGCGCCAAGCTCCTGCTGGGCCCCAACGACGCGCCCGCTGGCCCCTGA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T41171-Ab | Anti-IL17D/ IL27/ IL-17D functional antibody |
Target Antigen | GM-Tg-g-T41171-Ag | IL27/IL17D protein |
Cytokine | cks-Tg-g-GM-T41171 | interleukin 17D (IL17D) protein & antibody |
ORF Viral Vector | pGMLP003442 | Human IL17D Lentivirus plasmid |
ORF Viral Vector | pGMLP-IL-023 | Human IL17D Lentivirus plasmid |
ORF Viral Vector | pGMAP-IL-106 | Human IL17D Adenovirus plasmid |
ORF Viral Vector | vGMLP003442 | Human IL17D Lentivirus particle |
ORF Viral Vector | vGMLP-IL-023 | Human IL17D Lentivirus particle |
ORF Viral Vector | vGMAP-IL-106 | Human IL17D Adenovirus particle |
Target information
Target ID | GM-T41171 |
Target Name | IL27 |
Gene ID | 53342, 239114, 721163, 691799, 101093070, 102156421, 614982 |
Gene Symbol and Synonyms | IL-17D,IL17D |
Uniprot Accession | Q8TAD2 |
Uniprot Entry Name | IL17D_HUMAN |
Protein Sub-location | Secreted Protein/Potential Cytokines |
Category | Therapeutics Target, Cytokine Target |
Disease | Not Available |
Gene Ensembl | ENSG00000172458 |
Target Classification | Not Available |
The protein encoded by this gene is a cytokine that shares the sequence similarity with IL17. The treatment of endothelial cells with this cytokine has been shown to stimulate the production of other cytokines including IL6, IL8 and CSF2/ GM-CSF. The increased expression of IL8 induced by this cytokine was found to be NF-kappa B-dependent. [provided by RefSeq, Jul 2008]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.