Human IL17D/IL-17D ORF/cDNA clone-Lentivirus particle (NM_138284)

Pre-made Human IL17D/IL-17D Lentiviral expression plasmid for IL17D lentivirus packaging, IL17D lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collectionGo to IL27/IL17D/IL-17D products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP003442 Human IL17D Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP003442
Gene Name IL17D
Accession Number NM_138284
Gene ID 53342
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 609 bp
Gene Alias IL-17D
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGCTGGTAGCCGGCTTCCTGCTGGCGCTGCCGCCGAGCTGGGCCGCGGGCGCCCCGAGGGCGGGCAGGCGCCCCGCGCGGCCGCGGGGCTGCGCGGACCGGCCGGAGGAGCTACTGGAGCAGCTGTACGGGCGCCTGGCGGCCGGCGTGCTCAGTGCCTTCCACCACACGCTGCAGCTGGGGCCGCGTGAGCAGGCGCGCAACGCGAGCTGCCCGGCAGGGGGCAGGCCCGCCGACCGCCGCTTCCGGCCGCCCACCAACCTGCGCAGCGTGTCGCCCTGGGCCTACAGAATCTCCTACGACCCGGCGAGGTACCCCAGGTACCTGCCTGAAGCCTACTGCCTGTGCCGGGGCTGCCTGACCGGGCTGTTCGGCGAGGAGGACGTGCGCTTCCGCAGCGCCCCTGTCTACATGCCCACCGTCGTCCTGCGCCGCACCCCCGCCTGCGCCGGCGGCCGTTCCGTCTACACCGAGGCCTACGTCACCATCCCCGTGGGCTGCACCTGCGTCCCCGAGCCGGAGAAGGACGCAGACAGCATCAACTCCAGCATCGACAAACAGGGCGCCAAGCTCCTGCTGGGCCCCAACGACGCGCCCGCTGGCCCCTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T41171-Ab Anti-IL17D/ IL27/ IL-17D functional antibody
    Target Antigen GM-Tg-g-T41171-Ag IL27/IL17D protein
    Cytokine cks-Tg-g-GM-T41171 interleukin 17D (IL17D) protein & antibody
    ORF Viral Vector pGMLP003442 Human IL17D Lentivirus plasmid
    ORF Viral Vector pGMLP-IL-023 Human IL17D Lentivirus plasmid
    ORF Viral Vector pGMAP-IL-106 Human IL17D Adenovirus plasmid
    ORF Viral Vector vGMLP003442 Human IL17D Lentivirus particle
    ORF Viral Vector vGMLP-IL-023 Human IL17D Lentivirus particle
    ORF Viral Vector vGMAP-IL-106 Human IL17D Adenovirus particle


    Target information

    Target ID GM-T41171
    Target Name IL27
    Gene ID 53342, 239114, 721163, 691799, 101093070, 102156421, 614982
    Gene Symbol and Synonyms IL-17D,IL17D
    Uniprot Accession Q8TAD2
    Uniprot Entry Name IL17D_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Therapeutics Target, Cytokine Target
    Disease Not Available
    Gene Ensembl ENSG00000172458
    Target Classification Not Available

    The protein encoded by this gene is a cytokine that shares the sequence similarity with IL17. The treatment of endothelial cells with this cytokine has been shown to stimulate the production of other cytokines including IL6, IL8 and CSF2/ GM-CSF. The increased expression of IL8 induced by this cytokine was found to be NF-kappa B-dependent. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.