Human SOD3/EC-SOD ORF/cDNA clone-Lentivirus plasmid (NM_003102)
Cat. No.: pGMLP003476
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days
Pre-made Human SOD3/EC-SOD Lentiviral expression plasmid for SOD3 lentivirus packaging, SOD3 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go to
SOD3/EC-SOD products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product Description
Catalog ID | pGMLP003476 |
Gene Name | SOD3 |
Accession Number | NM_003102 |
Gene ID | 6649 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 723 bp |
Gene Alias | EC-SOD |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
ORF Nucleotide Sequence | ATGCTGGCGCTACTGTGTTCCTGCCTGCTCCTGGCAGCCGGTGCCTCGGACGCCTGGACGGGCGAGGACTCGGCGGAGCCCAACTCTGACTCGGCGGAGTGGATCCGAGACATGTACGCCAAGGTCACGGAGATCTGGCAGGAGGTCATGCAGCGGCGGGACGACGACGGCGCGCTCCACGCCGCCTGCCAGGTGCAGCCGTCGGCCACGCTGGACGCCGCGCAGCCCCGGGTGACCGGCGTCGTCCTCTTCCGGCAGCTTGCGCCCCGCGCCAAGCTCGACGCCTTCTTCGCCCTGGAGGGCTTCCCGACCGAGCCGAACAGCTCCAGCCGCGCCATCCACGTGCACCAGTTCGGGGACCTGAGCCAGGGCTGCGAGTCCACCGGGCCCCACTACAACCCGCTGGCCGTGCCGCACCCGCAGCACCCGGGCGACTTCGGCAACTTCGCGGTCCGCGACGGCAGCCTCTGGAGGTACCGCGCCGGCCTGGCCGCCTCGCTCGCGGGCCCGCACTCCATCGTGGGCCGGGCCGTGGTCGTCCACGCTGGCGAGGACGACCTGGGCCGCGGCGGCAACCAGGCCAGCGTGGAGAACGGGAACGCGGGCCGGCGGCTGGCCTGCTGCGTGGTGGGCGTGTGCGGGCCCGGGCTCTGGGAGCGCCAGGCGCGGGAGCACTCAGAGCGCAAGAAGCGGCGGCGCGAGAGCGAGTGCAAGGCCGCCTGA |
ORF Protein Sequence | MLALLCSCLLLAAGASDAWTGEDSAEPNSDSAEWIRDMYAKVTEIWQEVMQRRDDDGALHAACQVQPSATLDAAQPRVTGVVLFRQLAPRAKLDAFFALEGFPTEPNSSSRAIHVHQFGDLSQGCESTGPHYNPLAVPHPQHPGDFGNFAVRDGSLWRYRAGLAASLAGPHSIVGRAVVVHAGEDDLGRGGNQASVENGNAGRRLACCVVGVCGPGLWERQAREHSERKKRRRESECKAA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-SE1299-Ab | Anti-SODE/ SOD3/ EC-SOD functional antibody |
Target Antigen | GM-Tg-g-SE1299-Ag | SOD3 protein |
ORF Viral Vector | pGMLP003476 | Human SOD3 Lentivirus plasmid |
ORF Viral Vector | vGMLP003476 | Human SOD3 Lentivirus particle |
Target information
Target ID | GM-SE1299 |
Target Name | SOD3 |
Gene ID | 6649, 20657, 715931, 25352, 111560198, 488855, 532481, 100146988 |
Gene Symbol and Synonyms | EC-SOD,ECSOD,ECSODPT,SOD3 |
Uniprot Accession | P08294 |
Uniprot Entry Name | SODE_HUMAN |
Protein Sub-location | Secreted Protein/Potential Cytokines |
Category | Not Available |
Disease | Ovary Cancer, IgA glomerulonephritis |
Gene Ensembl | ENSG00000109610 |
Target Classification | Not Available |
This gene encodes a member of the superoxide dismutase (SOD) protein family. SODs are antioxidant enzymes that catalyze the conversion of superoxide radicals into hydrogen peroxide and oxygen, which may protect the brain, lungs, and other tissues from oxidative stress. Proteolytic processing of the encoded protein results in the formation of two distinct homotetramers that differ in their ability to interact with the extracellular matrix (ECM). Homotetramers consisting of the intact protein, or type C subunit, exhibit high affinity for heparin and are anchored to the ECM. Homotetramers consisting of a proteolytically cleaved form of the protein, or type A subunit, exhibit low affinity for heparin and do not interact with the ECM. A mutation in this gene may be associated with increased heart disease risk. [provided by RefSeq, Oct 2015]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.