Human SOD3/EC-SOD ORF/cDNA clone-Lentivirus particle (NM_003102)

Cat. No.: vGMLP003476

Pre-made Human SOD3/EC-SOD Lentiviral expression plasmid for SOD3 lentivirus packaging, SOD3 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collection

Go to SOD3/EC-SOD products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP003476 Human SOD3 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP003476
Gene Name SOD3
Accession Number NM_003102
Gene ID 6649
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 723 bp
Gene Alias EC-SOD
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGCTGGCGCTACTGTGTTCCTGCCTGCTCCTGGCAGCCGGTGCCTCGGACGCCTGGACGGGCGAGGACTCGGCGGAGCCCAACTCTGACTCGGCGGAGTGGATCCGAGACATGTACGCCAAGGTCACGGAGATCTGGCAGGAGGTCATGCAGCGGCGGGACGACGACGGCGCGCTCCACGCCGCCTGCCAGGTGCAGCCGTCGGCCACGCTGGACGCCGCGCAGCCCCGGGTGACCGGCGTCGTCCTCTTCCGGCAGCTTGCGCCCCGCGCCAAGCTCGACGCCTTCTTCGCCCTGGAGGGCTTCCCGACCGAGCCGAACAGCTCCAGCCGCGCCATCCACGTGCACCAGTTCGGGGACCTGAGCCAGGGCTGCGAGTCCACCGGGCCCCACTACAACCCGCTGGCCGTGCCGCACCCGCAGCACCCGGGCGACTTCGGCAACTTCGCGGTCCGCGACGGCAGCCTCTGGAGGTACCGCGCCGGCCTGGCCGCCTCGCTCGCGGGCCCGCACTCCATCGTGGGCCGGGCCGTGGTCGTCCACGCTGGCGAGGACGACCTGGGCCGCGGCGGCAACCAGGCCAGCGTGGAGAACGGGAACGCGGGCCGGCGGCTGGCCTGCTGCGTGGTGGGCGTGTGCGGGCCCGGGCTCTGGGAGCGCCAGGCGCGGGAGCACTCAGAGCGCAAGAAGCGGCGGCGCGAGAGCGAGTGCAAGGCCGCCTGA
ORF Protein Sequence MLALLCSCLLLAAGASDAWTGEDSAEPNSDSAEWIRDMYAKVTEIWQEVMQRRDDDGALHAACQVQPSATLDAAQPRVTGVVLFRQLAPRAKLDAFFALEGFPTEPNSSSRAIHVHQFGDLSQGCESTGPHYNPLAVPHPQHPGDFGNFAVRDGSLWRYRAGLAASLAGPHSIVGRAVVVHAGEDDLGRGGNQASVENGNAGRRLACCVVGVCGPGLWERQAREHSERKKRRRESECKAA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE1299-Ab Anti-SODE/ SOD3/ EC-SOD functional antibody
    Target Antigen GM-Tg-g-SE1299-Ag SOD3 protein
    ORF Viral Vector pGMLP003476 Human SOD3 Lentivirus plasmid
    ORF Viral Vector vGMLP003476 Human SOD3 Lentivirus particle


    Target information

    Target ID GM-SE1299
    Target Name SOD3
    Gene ID 6649, 20657, 715931, 25352, 111560198, 488855, 532481, 100146988
    Gene Symbol and Synonyms EC-SOD,ECSOD,ECSODPT,SOD3
    Uniprot Accession P08294
    Uniprot Entry Name SODE_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Not Available
    Disease Ovary Cancer, IgA glomerulonephritis
    Gene Ensembl ENSG00000109610
    Target Classification Not Available

    This gene encodes a member of the superoxide dismutase (SOD) protein family. SODs are antioxidant enzymes that catalyze the conversion of superoxide radicals into hydrogen peroxide and oxygen, which may protect the brain, lungs, and other tissues from oxidative stress. Proteolytic processing of the encoded protein results in the formation of two distinct homotetramers that differ in their ability to interact with the extracellular matrix (ECM). Homotetramers consisting of the intact protein, or type C subunit, exhibit high affinity for heparin and are anchored to the ECM. Homotetramers consisting of a proteolytically cleaved form of the protein, or type A subunit, exhibit low affinity for heparin and do not interact with the ECM. A mutation in this gene may be associated with increased heart disease risk. [provided by RefSeq, Oct 2015]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.