Human MC1R/CMM5/ MSH-R ORF/cDNA clone-Lentivirus plasmid (NM_002386)
Pre-made Human MC1R/CMM5/ MSH-R Lentiviral expression plasmid for MC1R lentivirus packaging, MC1R lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go
to MC1R/CMM5 products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Plasmid Grade | Plasmid quantity |
---|---|---|---|
pGMLP003534 | Human MC1R Lentivirus plasmid | Research Grade | 10mg, 50mg, 100mg, 500mg, >1g |
GMP-like Grade | 10mg, 50mg, 100mg, 500mg, >1g | ||
High Quality (HQ) Grade | |||
Seed | 5ug |
Product Description
Catalog ID | pGMLP003534 |
Gene Name | MC1R |
Accession Number | NM_002386 |
Gene ID | 4157 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 954 bp |
Gene Alias | CMM5, MSH-R, SHEP2 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGGCTGTGCAGGGATCCCAGAGAAGACTTCTGGGCTCCCTCAACTCCACCCCCACAGCCATCCCCCAGCTGGGGCTGGCTGCCAACCAGACAGGAGCCCGGTGCCTGGAGGTGTCCATCTCTGACGGGCTCTTCCTCAGCCTGGGGCTGGTGAGCTTGGTGGAGAACGCGCTGGTGGTGGCCACCATCGCCAAGAACCGGAACCTGCACTCACCCATGTACTGCTTCATCTGCTGCCTGGCCTTGTCGGACCTGCTGGTGAGCGGGAGCAACGTGCTGGAGACGGCCGTCATCCTCCTGCTGGAGGCCGGTGCACTGGTGGCCCGGGCTGCGGTGCTGCAGCAGCTGGACAATGTCATTGACGTGATCACCTGCAGCTCCATGCTGTCCAGCCTCTGCTTCCTGGGCGCCATCGCCGTGGACCGCTACATCTCCATCTTCTACGCACTGCGCTACCACAGCATCGTGACCCTGCCGCGGGCGCGGCGAGCCGTTGCGGCCATCTGGGTGGCCAGTGTCGTCTTCAGCACGCTCTTCATCGCCTACTACGACCACGTGGCCGTCCTGCTGTGCCTCGTGGTCTTCTTCCTGGCTATGCTGGTGCTCATGGCCGTGCTGTACGTCCACATGCTGGCCCGGGCCTGCCAGCACGCCCAGGGCATCGCCCGGCTCCACAAGAGGCAGCGCCCGGTCCACCAGGGCTTTGGCCTTAAAGGCGCTGTCACCCTCACCATCCTGCTGGGCATTTTCTTCCTCTGCTGGGGCCCCTTCTTCCTGCATCTCACACTCATCGTCCTCTGCCCCGAGCACCCCACGTGCGGCTGCATCTTCAAGAACTTCAACCTCTTTCTCGCCCTCATCATCTGCAATGCCATCATCGACCCCCTCATCTACGCCTTCCACAGCCAGGAGCTCCGCAGGACGCTCAAGGAGGTGCTGACATGCTCCTGGTGA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T35842-Ab | Anti-MSHR/ MC1R/ CMM5 monoclonal antibody |
Target Antigen | GM-Tg-g-T35842-Ag | MC1R VLP (virus-like particle) |
ORF Viral Vector | pGMLP003534 | Human MC1R Lentivirus plasmid |
ORF Viral Vector | vGMLP003534 | Human MC1R Lentivirus particle |
Target information
Target ID | GM-T35842 |
Target Name | MC1R |
Gene ID | 4157, 17199, 102552838, 493917, 489652, 281298, 100136907 |
Gene Symbol and Synonyms | CMM5,e,MC1-R,MC1R,Mcr1,MSH-R,MSHR,Mshra,SHEP2,Tob |
Uniprot Accession | Q01726 |
Uniprot Entry Name | MSHR_HUMAN |
Protein Sub-location | Transmembrane Protein |
Category | Therapeutics Target |
Disease | Cancer |
Gene Ensembl | ENSG00000258839 |
Target Classification | GPCR, Tumor-associated antigen (TAA) |
This intronless gene encodes the receptor protein for melanocyte-stimulating hormone (MSH). The encoded protein, a seven pass transmembrane G protein coupled receptor, controls melanogenesis. Two types of melanin exist: red pheomelanin and black eumelanin. Gene mutations that lead to a loss in function are associated with increased pheomelanin production, which leads to lighter skin and hair color. Eumelanin is photoprotective but pheomelanin may contribute to UV-induced skin damage by generating free radicals upon UV radiation. Binding of MSH to its receptor activates the receptor and stimulates eumelanin synthesis. This receptor is a major determining factor in sun sensitivity and is a genetic risk factor for melanoma and non-melanoma skin cancer. Over 30 variant alleles have been identified which correlate with skin and hair color, providing evidence that this gene is an important component in determining normal human pigment variation. [provided by RefSeq, Jul 2008]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.