Human AMD1/ADOMETDC/ AMD ORF/cDNA clone-Lentivirus plasmid (NM_001634)
Pre-made Human AMD1/ADOMETDC/ AMD Lentiviral expression plasmid for AMD1 lentivirus packaging, AMD1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go
to AMD1/ADOMETDC products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Plasmid Grade | Plasmid quantity |
---|---|---|---|
pGMLP003549 | Human AMD1 Lentivirus plasmid | Research Grade | 10mg, 50mg, 100mg, 500mg, >1g |
GMP-like Grade | 10mg, 50mg, 100mg, 500mg, >1g | ||
High Quality (HQ) Grade | |||
Seed | 5ug |
Product Description
Catalog ID | pGMLP003549 |
Gene Name | AMD1 |
Accession Number | NM_001634 |
Gene ID | 262 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 1005 bp |
Gene Alias | ADOMETDC, AMD, SAMDC |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGGAAGCTGCACATTTTTTCGAAGGGACCGAGAAGCTGCTGGAGGTTTGGTTCTCCCGGCAGCAGCCCGACGCAAACCAAGGATCTGGGGATCTTCGCACTATCCCAAGATCTGAGTGGGACATACTTTTGAAGGATGTGCAATGTTCAATCATAAGTGTGACAAAAACTGACAAGCAGGAAGCTTATGTACTCAGTGAGAGTAGCATGTTTGTCTCCAAGAGACGTTTCATTTTGAAGACATGTGGTACCACCCTCTTGCTGAAAGCACTGGTTCCCCTGTTGAAGCTTGCTAGGGATTACAGTGGGTTTGACTCAATTCAAAGCTTCTTTTATTCTCGTAAGAATTTCATGAAGCCTTCTCACCAAGGGTACCCACACCGGAATTTCCAGGAAGAAATAGAGTTTCTTAATGCAATTTTCCCAAATGGAGCAGCATATTGTATGGGACGTATGAATTCTGACTGTTGGTACTTATATACTCTGGATTTCCCAGAGAGTCGGGTAATCAGTCAGCCAGATCAAACCTTGGAAATTCTGATGAGTGAGCTTGACCCAGCAGTTATGGACCAGTTCTACATGAAAGATGGTGTTACTGCAAAGGATGTCACTCGTGAGAGTGGAATTCGTGACCTGATACCAGGTTCTGTCATTGATGCCACAATGTTCAATCCTTGTGGGTATTCGATGAATGGAATGAAATCGGATGGAACTTATTGGACTATTCACATCACTCCAGAACCAGAATTTTCTTATGTTAGCTTTGAAACAAACTTAAGTCAGACCTCCTATGATGACCTGATCAGGAAAGTTGTAGAAGTCTTCAAGCCAGGAAAATTTGTGACCACCTTGTTTGTTAATCAGAGTTCTAAATGTCGCACAGTGCTTGCTTCGCCCCAGAAGATTGAAGGTTTTAAGCGTCTTGATTGCCAGAGTGCTATGTTCAATGATTACAATTTTGTTTTTACCAGTTTTGCTAAGAAGCAGCAACAACAGCAGAGTTGA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T55922-Ab | Anti-AMD1 monoclonal antibody |
Target Antigen | GM-Tg-g-T55922-Ag | AMD1 protein |
ORF Viral Vector | pGMLP003549 | Human AMD1 Lentivirus plasmid |
ORF Viral Vector | vGMLP003549 | Human AMD1 Lentivirus particle |
Target information
Target ID | GM-T55922 |
Target Name | AMD1 |
Gene ID | 262, 11702, 698042, 81640, 101084109, 481960, 280997, 100072355 |
Gene Symbol and Synonyms | ADOMETDC,adoMetDC1,AMD,Amd-1,AMD1,Amd1a,Amd1b,SAMDC,SAMDC 1 |
Uniprot Accession | P17707 |
Uniprot Entry Name | DCAM_HUMAN |
Protein Sub-location | Introcelluar Protein |
Category | Therapeutics Target |
Disease | Prostate Cancer |
Gene Ensembl | ENSG00000123505 |
Target Classification | Not Available |
This gene encodes an important intermediate enzyme in polyamine biosynthesis. The polyamines spermine, spermidine, and putrescine are low-molecular-weight aliphatic amines essential for cellular proliferation and tumor promotion. Multiple alternatively spliced transcript variants have been identified. Pseudogenes of this gene are found on chromosomes 5, 6, 10, X and Y. [provided by RefSeq, Dec 2013]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.