Human AMD1/ADOMETDC/ AMD ORF/cDNA clone-Lentivirus particle (NM_001634)

Pre-made Human AMD1/ADOMETDC/ AMD Lentiviral expression plasmid for AMD1 lentivirus packaging, AMD1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collectionGo to AMD1/ADOMETDC products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP003549 Human AMD1 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP003549
Gene Name AMD1
Accession Number NM_001634
Gene ID 262
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 1005 bp
Gene Alias ADOMETDC, AMD, SAMDC
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGGAAGCTGCACATTTTTTCGAAGGGACCGAGAAGCTGCTGGAGGTTTGGTTCTCCCGGCAGCAGCCCGACGCAAACCAAGGATCTGGGGATCTTCGCACTATCCCAAGATCTGAGTGGGACATACTTTTGAAGGATGTGCAATGTTCAATCATAAGTGTGACAAAAACTGACAAGCAGGAAGCTTATGTACTCAGTGAGAGTAGCATGTTTGTCTCCAAGAGACGTTTCATTTTGAAGACATGTGGTACCACCCTCTTGCTGAAAGCACTGGTTCCCCTGTTGAAGCTTGCTAGGGATTACAGTGGGTTTGACTCAATTCAAAGCTTCTTTTATTCTCGTAAGAATTTCATGAAGCCTTCTCACCAAGGGTACCCACACCGGAATTTCCAGGAAGAAATAGAGTTTCTTAATGCAATTTTCCCAAATGGAGCAGCATATTGTATGGGACGTATGAATTCTGACTGTTGGTACTTATATACTCTGGATTTCCCAGAGAGTCGGGTAATCAGTCAGCCAGATCAAACCTTGGAAATTCTGATGAGTGAGCTTGACCCAGCAGTTATGGACCAGTTCTACATGAAAGATGGTGTTACTGCAAAGGATGTCACTCGTGAGAGTGGAATTCGTGACCTGATACCAGGTTCTGTCATTGATGCCACAATGTTCAATCCTTGTGGGTATTCGATGAATGGAATGAAATCGGATGGAACTTATTGGACTATTCACATCACTCCAGAACCAGAATTTTCTTATGTTAGCTTTGAAACAAACTTAAGTCAGACCTCCTATGATGACCTGATCAGGAAAGTTGTAGAAGTCTTCAAGCCAGGAAAATTTGTGACCACCTTGTTTGTTAATCAGAGTTCTAAATGTCGCACAGTGCTTGCTTCGCCCCAGAAGATTGAAGGTTTTAAGCGTCTTGATTGCCAGAGTGCTATGTTCAATGATTACAATTTTGTTTTTACCAGTTTTGCTAAGAAGCAGCAACAACAGCAGAGTTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T55922-Ab Anti-AMD1 monoclonal antibody
    Target Antigen GM-Tg-g-T55922-Ag AMD1 protein
    ORF Viral Vector pGMLP003549 Human AMD1 Lentivirus plasmid
    ORF Viral Vector vGMLP003549 Human AMD1 Lentivirus particle


    Target information

    Target ID GM-T55922
    Target Name AMD1
    Gene ID 262, 11702, 698042, 81640, 101084109, 481960, 280997, 100072355
    Gene Symbol and Synonyms ADOMETDC,adoMetDC1,AMD,Amd-1,AMD1,Amd1a,Amd1b,SAMDC,SAMDC 1
    Uniprot Accession P17707
    Uniprot Entry Name DCAM_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target
    Disease Prostate Cancer
    Gene Ensembl ENSG00000123505
    Target Classification Not Available

    This gene encodes an important intermediate enzyme in polyamine biosynthesis. The polyamines spermine, spermidine, and putrescine are low-molecular-weight aliphatic amines essential for cellular proliferation and tumor promotion. Multiple alternatively spliced transcript variants have been identified. Pseudogenes of this gene are found on chromosomes 5, 6, 10, X and Y. [provided by RefSeq, Dec 2013]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.