Human CCR8/CC-CKR-8/ CCR-8 ORF/cDNA clone-Lentivirus plasmid (NM_005201)
Pre-made Human CCR8/CC-CKR-8/ CCR-8 Lentiviral expression plasmid for CCR8 lentivirus packaging, CCR8 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go
to CCR8/CC-CKR-8 products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Plasmid Grade | Plasmid quantity |
---|---|---|---|
pGMLP003581 | Human CCR8 Lentivirus plasmid | Research Grade | 10mg, 50mg, 100mg, 500mg, >1g |
GMP-like Grade | 10mg, 50mg, 100mg, 500mg, >1g | ||
High Quality (HQ) Grade | |||
Seed | 5ug |
Product Description
Catalog ID | pGMLP003581 |
Gene Name | CCR8 |
Accession Number | NM_005201 |
Gene ID | 1237 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 1068 bp |
Gene Alias | CC-CKR-8, CCR-8, CDw198, CKRL1, CMKBR8, CMKBRL2, CY6, GPRCY6, TER1 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGGATTATACACTTGACCTCAGTGTGACAACAGTGACCGACTACTACTACCCTGATATCTTCTCAAGCCCCTGTGATGCGGAACTTATTCAGACAAATGGCAAGTTGCTCCTTGCTGTCTTTTATTGCCTCCTGTTTGTATTCAGTCTTCTGGGAAACAGCCTGGTCATCCTGGTCCTTGTGGTCTGCAAGAAGCTGAGGAGCATCACAGATGTATACCTCTTGAACCTGGCCCTGTCTGACCTGCTTTTTGTCTTCTCCTTCCCCTTTCAGACCTACTATCTGCTGGACCAGTGGGTGTTTGGGACTGTAATGTGCAAAGTGGTGTCTGGCTTTTATTACATTGGCTTCTACAGCAGCATGTTTTTCATCACCCTCATGAGTGTGGACAGGTACCTGGCTGTTGTCCATGCCGTGTATGCCCTAAAGGTGAGGACGATCAGGATGGGCACAACGCTGTGCCTGGCAGTATGGCTAACCGCCATTATGGCTACCATCCCATTGCTAGTGTTTTACCAAGTGGCCTCTGAAGATGGTGTTCTACAGTGTTATTCATTTTACAATCAACAGACTTTGAAGTGGAAGATCTTCACCAACTTCAAAATGAACATTTTAGGCTTGTTGATCCCATTCACCATCTTTATGTTCTGCTACATTAAAATCCTGCACCAGCTGAAGAGGTGTCAAAACCACAACAAGACCAAGGCCATCAGGTTGGTGCTCATTGTGGTCATTGCATCTTTACTTTTCTGGGTCCCATTCAACGTGGTTCTTTTCCTCACTTCCTTGCACAGTATGCACATCTTGGATGGATGTAGCATAAGCCAACAGCTGACTTATGCCACCCATGTCACAGAAATCATTTCCTTTACTCACTGCTGTGTGAACCCTGTTATCTATGCTTTTGTTGGGGAGAAGTTCAAGAAACACCTCTCAGAAATATTTCAGAAAAGTTGCAGCCAAATCTTCAACTACCTAGGAAGACAAATGCCTAGGGAGAGCTGTGAAAAGTCATCATCCTGCCAGCAGCACTCCTCCCGTTCCTCCAGCGTAGACTACATTTTGTGA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T20575-Ab | Anti-CCR8/ CC-CKR-8/ CCR-8 monoclonal antibody |
Target Antigen | GM-Tg-g-T20575-Ag | CCR8 VLP (virus-like particle) |
Cytokine | cks-Tg-g-GM-T20575 | chemokine (C-C motif) receptor 8 (CCR8) protein & antibody |
ORF Viral Vector | pGMLP003581 | Human CCR8 Lentivirus plasmid |
ORF Viral Vector | vGMLP003581 | Human CCR8 Lentivirus particle |
Target information
Target ID | GM-T20575 |
Target Name | CCR8 |
Gene ID | 1237, 12776, 693806, 301066, 101099650, 485600, 407772, 100055409 |
Gene Symbol and Synonyms | C-C,C-C CKR-8,CC-CKR-8,CCR-8,CCR8,CDw198,CKR-8,CKRL1,CMKBR8,CMKBRL2,CY6,GPRCY6,mCCR8,TER1 |
Uniprot Accession | P51685 |
Uniprot Entry Name | CCR8_HUMAN |
Protein Sub-location | Transmembrane Protein |
Category | Therapeutics Target, Cytokine Target |
Disease | Not Available |
Gene Ensembl | ENSG00000179934 |
Target Classification | GPCR |
This gene encodes a member of the beta chemokine receptor family, which is predicted to be a seven transmembrane protein similar to G protein-coupled receptors. Chemokines and their receptors are important for the migration of various cell types into the inflammatory sites. This receptor protein preferentially expresses in the thymus. I-309, thymus activation-regulated cytokine (TARC) and macrophage inflammatory protein-1 beta (MIP-1 beta) have been identified as ligands of this receptor. Studies of this receptor and its ligands suggested its role in regulation of monocyte chemotaxis and thymic cell apoptosis. More specifically, this receptor may contribute to the proper positioning of activated T cells within the antigenic challenge sites and specialized areas of lymphoid tissues. This gene is located at the chemokine receptor gene cluster region. [provided by RefSeq, Jul 2008]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.