Human GPR20 ORF/cDNA clone-Lentivirus plasmid (NM_005293)
Pre-made Human GPR20/ Lentiviral expression plasmid for GPR20 lentivirus packaging, GPR20 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go
to GPR20/ products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Plasmid Grade | Plasmid quantity |
---|---|---|---|
pGMLP003584 | Human GPR20 Lentivirus plasmid | Research Grade | 10mg, 50mg, 100mg, 500mg, >1g |
GMP-like Grade | 10mg, 50mg, 100mg, 500mg, >1g | ||
High Quality (HQ) Grade | |||
Seed | 5ug |
Product Description
Catalog ID | pGMLP003584 |
Gene Name | GPR20 |
Accession Number | NM_005293 |
Gene ID | 2843 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 1077 bp |
Gene Alias | |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGCCCTCTGTGTCTCCAGCGGGGCCCTCGGCCGGGGCAGTCCCCAATGCCACCGCAGTGACAACAGTGCGGACCAATGCCAGCGGGCTGGAGGTGCCCCTGTTCCACCTGTTTGCCCGGCTGGACGAGGAGCTGCATGGCACCTTCCCAGGCCTGTGGCTGGCGCTGATGGCGGTGCACGGAGCCATCTTCCTGGCAGGGCTGGTGCTCAACGGGCTGGCGCTGTACGTCTTCTGCTGCCGCACCCGGGCCAAGACACCCTCAGTCATCTACACCATCAACCTGGTGGTGACCGATCTACTGGTAGGGCTGTCCCTGCCCACGCGCTTCGCTGTGTACTACGGCGCCAGGGGCTGCCTGCGCTGTGCCTTCCCGCACGTCCTCGGTTACTTCCTCAACATGCACTGCTCCATCCTCTTCCTCACCTGCATCTGCGTGGACCGCTACCTGGCCATCGTGCGGCCCGAAGGCTCCCGCCGCTGCCGCCAGCCTGCCTGTGCCAGGGCCGTGTGCGCCTTCGTGTGGCTGGCCGCCGGTGCCGTCACCCTGTCGGTGCTGGGCGTGACAGGCAGCCGGCCCTGCTGCCGTGTCTTTGCGCTGACTGTCCTGGAGTTCCTGCTGCCCCTGCTGGTCATCAGCGTGTTTACCGGCCGCATCATGTGTGCACTGTCGCGGCCGGGTCTGCTCCACCAGGGTCGCCAGCGCCGCGTGCGGGCCATGCAGCTCCTGCTCACGGTGCTCATCATCTTTCTCGTCTGCTTCACGCCCTTCCACGCCCGCCAAGTGGCCGTGGCGCTGTGGCCCGACATGCCACACCACACGAGCCTCGTGGTCTACCACGTGGCCGTGACCCTCAGCAGCCTCAACAGCTGCATGGACCCCATCGTCTACTGCTTCGTCACCAGTGGCTTCCAGGCCACCGTCCGAGGCCTCTTCGGCCAGCACGGAGAGCGTGAGCCCAGCAGCGGTGACGTGGTCAGCATGCACAGGAGCTCCAAGGGCTCAGGCCGTCATCACATCCTCAGTGCCGGCCCTCACGCCCTCACCCAGGCCCTGGCTAATGGGCCCGAGGCTTAG |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T65429-Ab | Anti-GPR20 monoclonal antibody |
Target Antigen | GM-Tg-g-T65429-Ag | GPR20 VLP (virus-like particle) |
ORF Viral Vector | pGMLP003584 | Human GPR20 Lentivirus plasmid |
ORF Viral Vector | vGMLP003584 | Human GPR20 Lentivirus particle |
Target information
Target ID | GM-T65429 |
Target Name | GPR20 |
Gene ID | 2843, 239530, 693582, 60667, 109496266, 482061, 515695, 100069651 |
Gene Symbol and Synonyms | A430106B11Rik,Gpcr5-1,GPR20,P2Y4 |
Uniprot Accession | Q99678 |
Uniprot Entry Name | GPR20_HUMAN |
Protein Sub-location | Transmembrane Protein |
Category | Therapeutics Target |
Disease | Not Available |
Gene Ensembl | ENSG00000204882 |
Target Classification | GPCR |
Enables G protein-coupled receptor activity. Predicted to be involved in positive regulation of Rho protein signal transduction and positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G protein-coupled signaling pathway. Located in cytosol and plasma membrane. Is integral component of plasma membrane. Part of receptor complex.
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.