Human GPR20 ORF/cDNA clone-Lentivirus plasmid (NM_005293)

Pre-made Human GPR20/ Lentiviral expression plasmid for GPR20 lentivirus packaging, GPR20 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

Target products collectionGo to GPR20/ products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMLP003584 Human GPR20 Lentivirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMLP003584
Gene Name GPR20
Accession Number NM_005293
Gene ID 2843
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 1077 bp
Gene Alias
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGCCCTCTGTGTCTCCAGCGGGGCCCTCGGCCGGGGCAGTCCCCAATGCCACCGCAGTGACAACAGTGCGGACCAATGCCAGCGGGCTGGAGGTGCCCCTGTTCCACCTGTTTGCCCGGCTGGACGAGGAGCTGCATGGCACCTTCCCAGGCCTGTGGCTGGCGCTGATGGCGGTGCACGGAGCCATCTTCCTGGCAGGGCTGGTGCTCAACGGGCTGGCGCTGTACGTCTTCTGCTGCCGCACCCGGGCCAAGACACCCTCAGTCATCTACACCATCAACCTGGTGGTGACCGATCTACTGGTAGGGCTGTCCCTGCCCACGCGCTTCGCTGTGTACTACGGCGCCAGGGGCTGCCTGCGCTGTGCCTTCCCGCACGTCCTCGGTTACTTCCTCAACATGCACTGCTCCATCCTCTTCCTCACCTGCATCTGCGTGGACCGCTACCTGGCCATCGTGCGGCCCGAAGGCTCCCGCCGCTGCCGCCAGCCTGCCTGTGCCAGGGCCGTGTGCGCCTTCGTGTGGCTGGCCGCCGGTGCCGTCACCCTGTCGGTGCTGGGCGTGACAGGCAGCCGGCCCTGCTGCCGTGTCTTTGCGCTGACTGTCCTGGAGTTCCTGCTGCCCCTGCTGGTCATCAGCGTGTTTACCGGCCGCATCATGTGTGCACTGTCGCGGCCGGGTCTGCTCCACCAGGGTCGCCAGCGCCGCGTGCGGGCCATGCAGCTCCTGCTCACGGTGCTCATCATCTTTCTCGTCTGCTTCACGCCCTTCCACGCCCGCCAAGTGGCCGTGGCGCTGTGGCCCGACATGCCACACCACACGAGCCTCGTGGTCTACCACGTGGCCGTGACCCTCAGCAGCCTCAACAGCTGCATGGACCCCATCGTCTACTGCTTCGTCACCAGTGGCTTCCAGGCCACCGTCCGAGGCCTCTTCGGCCAGCACGGAGAGCGTGAGCCCAGCAGCGGTGACGTGGTCAGCATGCACAGGAGCTCCAAGGGCTCAGGCCGTCATCACATCCTCAGTGCCGGCCCTCACGCCCTCACCCAGGCCCTGGCTAATGGGCCCGAGGCTTAG

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T65429-Ab Anti-GPR20 monoclonal antibody
    Target Antigen GM-Tg-g-T65429-Ag GPR20 VLP (virus-like particle)
    ORF Viral Vector pGMLP003584 Human GPR20 Lentivirus plasmid
    ORF Viral Vector vGMLP003584 Human GPR20 Lentivirus particle


    Target information

    Target ID GM-T65429
    Target Name GPR20
    Gene ID 2843, 239530, 693582, 60667, 109496266, 482061, 515695, 100069651
    Gene Symbol and Synonyms A430106B11Rik,Gpcr5-1,GPR20,P2Y4
    Uniprot Accession Q99678
    Uniprot Entry Name GPR20_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target
    Disease Not Available
    Gene Ensembl ENSG00000204882
    Target Classification GPCR

    Enables G protein-coupled receptor activity. Predicted to be involved in positive regulation of Rho protein signal transduction and positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G protein-coupled signaling pathway. Located in cytosol and plasma membrane. Is integral component of plasma membrane. Part of receptor complex.



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.