Human CXCR5/BLR1/ CD185 ORF/cDNA clone-Lentivirus plasmid (NM_001716)
Pre-made Human CXCR5/BLR1/ CD185 Lentiviral expression plasmid for CXCR5 lentivirus packaging, CXCR5 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go
to CXCR5/BLR1 products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Plasmid Grade | Plasmid quantity |
---|---|---|---|
pGMLP003601 | Human CXCR5 Lentivirus plasmid | Research Grade | 10mg, 50mg, 100mg, 500mg, >1g |
GMP-like Grade | 10mg, 50mg, 100mg, 500mg, >1g | ||
High Quality (HQ) Grade | |||
Seed | 5ug |
Product Description
Catalog ID | pGMLP003601 |
Gene Name | CXCR5 |
Accession Number | NM_001716 |
Gene ID | 643 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 1119 bp |
Gene Alias | BLR1, CD185, MDR15 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGAACTACCCGCTAACGCTGGAAATGGACCTCGAGAACCTGGAGGACCTGTTCTGGGAACTGGACAGATTGGACAACTATAACGACACCTCCCTGGTGGAAAATCATCTCTGCCCTGCCACAGAGGGGCCCCTCATGGCCTCCTTCAAGGCCGTGTTCGTGCCCGTGGCCTACAGCCTCATCTTCCTCCTGGGCGTGATCGGCAACGTCCTGGTGCTGGTGATCCTGGAGCGGCACCGGCAGACACGCAGTTCCACGGAGACCTTCCTGTTCCACCTGGCCGTGGCCGACCTCCTGCTGGTCTTCATCTTGCCCTTTGCCGTGGCCGAGGGCTCTGTGGGCTGGGTCCTGGGGACCTTCCTCTGCAAAACTGTGATTGCCCTGCACAAAGTCAACTTCTACTGCAGCAGCCTGCTCCTGGCCTGCATCGCCGTGGACCGCTACCTGGCCATTGTCCACGCCGTCCATGCCTACCGCCACCGCCGCCTCCTCTCCATCCACATCACCTGTGGGACCATCTGGCTGGTGGGCTTCCTCCTTGCCTTGCCAGAGATTCTCTTCGCCAAAGTCAGCCAAGGCCATCACAACAACTCCCTGCCACGTTGCACCTTCTCCCAAGAGAACCAAGCAGAAACGCATGCCTGGTTCACCTCCCGATTCCTCTACCATGTGGCGGGATTCCTGCTGCCCATGCTGGTGATGGGCTGGTGCTACGTGGGGGTAGTGCACAGGTTGCGCCAGGCCCAGCGGCGCCCTCAGCGGCAGAAGGCAGTCAGGGTGGCCATCCTGGTGACAAGCATCTTCTTCCTCTGCTGGTCACCCTACCACATCGTCATCTTCCTGGACACCCTGGCGAGGCTGAAGGCCGTGGACAATACCTGCAAGCTGAATGGCTCTCTCCCCGTGGCCATCACCATGTGTGAGTTCCTGGGCCTGGCCCACTGCTGCCTCAACCCCATGCTCTACACTTTCGCCGGCGTGAAGTTCCGCAGTGACCTGTCGCGGCTCCTGACGAAGCTGGGCTGTACCGGCCCTGCCTCCCTGTGCCAGCTCTTCCCTAGCTGGCGCAGGAGCAGTCTCTCTGAGTCAGAGAATGCCACCTCTCTCACCACGTTCTAG |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T09528-Ab | Anti-CXCR5/ BLR1/ CD185 monoclonal antibody |
Target Antigen | GM-Tg-g-T09528-Ag | CXCR5 VLP (virus-like particle) |
Cytokine | cks-Tg-g-GM-T09528 | chemokine (C-X-C motif) receptor 5 (CXCR5) protein & antibody |
ORF Viral Vector | pGMLP003601 | Human CXCR5 Lentivirus plasmid |
ORF Viral Vector | vGMLP003601 | Human CXCR5 Lentivirus particle |
Target information
Target ID | GM-T09528 |
Target Name | CXCR5 |
Gene ID | 643, 12145, 701792, 29363, 101092459, 489378, 497021 |
Gene Symbol and Synonyms | BLR1,CD185,CXC-R5,CXCR-5,CXCR5,Gpcr6,MDR15,NLR |
Uniprot Accession | P32302 |
Uniprot Entry Name | CXCR5_HUMAN |
Protein Sub-location | Transmembrane Protein |
Category | Therapeutics Target, Immuno-oncology Target, Cytokine Target |
Disease | Not Available |
Gene Ensembl | ENSG00000160683 |
Target Classification | Checkpoint-Immuno Oncology, GPCR |
This gene encodes a multi-pass membrane protein that belongs to the CXC chemokine receptor family. It is expressed in mature B-cells and Burkitt's lymphoma. This cytokine receptor binds to B-lymphocyte chemoattractant (BLC), and is involved in B-cell migration into B-cell follicles of spleen and Peyer patches. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Aug 2011]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.