Human OXTR/OT-R ORF/cDNA clone-Lentivirus plasmid (NM_000916)
Pre-made Human OXTR/OT-R Lentiviral expression plasmid for OXTR lentivirus packaging, OXTR lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go
to OTR/OXTR/OT-R products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Plasmid Grade | Plasmid quantity |
---|---|---|---|
pGMLP003633 | Human OXTR Lentivirus plasmid | Research Grade | 10mg, 50mg, 100mg, 500mg, >1g |
GMP-like Grade | 10mg, 50mg, 100mg, 500mg, >1g | ||
High Quality (HQ) Grade | |||
Seed | 5ug |
Product Description
Catalog ID | pGMLP003633 |
Gene Name | OXTR |
Accession Number | NM_000916 |
Gene ID | 5021 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 1170 bp |
Gene Alias | OT-R |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGGAGGGCGCGCTCGCAGCCAACTGGAGCGCCGAGGCAGCCAACGCCAGCGCCGCGCCGCCGGGGGCCGAGGGCAACCGCACCGCCGGACCCCCGCGGCGCAACGAGGCCCTGGCGCGCGTGGAGGTGGCGGTGCTGTGTCTCATCCTGCTCCTGGCGCTGAGCGGGAACGCGTGTGTGCTGCTGGCGCTGCGCACCACACGCCAGAAGCACTCGCGCCTCTTCTTCTTCATGAAGCACCTAAGCATCGCCGACCTGGTGGTGGCAGTGTTTCAGGTGCTGCCGCAGTTGCTGTGGGACATCACCTTCCGCTTCTACGGGCCCGACCTGCTGTGCCGCCTGGTCAAGTACTTGCAGGTGGTGGGCATGTTCGCCTCCACCTACCTGCTGCTGCTCATGTCCCTGGACCGCTGCCTGGCCATCTGCCAGCCGCTGCGCTCGCTGCGCCGCCGCACCGACCGCCTGGCAGTGCTCGCCACGTGGCTCGGCTGCCTGGTGGCCAGCGCGCCGCAGGTGCACATCTTCTCTCTGCGCGAGGTGGCTGACGGCGTCTTCGACTGCTGGGCCGTCTTCATCCAGCCCTGGGGACCCAAGGCCTACATCACATGGATCACGCTAGCTGTCTACATCGTGCCGGTCATCGTGCTCGCTGCCTGCTACGGCCTTATCAGCTTCAAGATCTGGCAGAACTTGCGGCTCAAGACCGCTGCAGCGGCGGCGGCCGAGGCGCCAGAGGGCGCGGCGGCTGGCGATGGGGGGCGCGTGGCCCTGGCGCGTGTCAGCAGCGTCAAGCTCATCTCCAAGGCCAAGATCCGCACGGTCAAGATGACTTTCATCATCGTGCTGGCCTTCATCGTGTGCTGGACGCCTTTCTTCTTCGTGCAGATGTGGAGCGTCTGGGATGCCAACGCGCCCAAGGAAGCCTCGGCCTTCATCATCGTCATGCTCCTGGCCAGCCTCAACAGCTGCTGCAACCCCTGGATCTACATGCTGTTCACGGGCCACCTCTTCCACGAACTCGTGCAGCGCTTCCTGTGCTGCTCCGCCAGCTACCTGAAGGGCAGACGCCTGGGAGAGACGAGTGCCAGCAAAAAGAGCAACTCGTCCTCCTTTGTCCTGAGCCATCGCAGCTCCAGCCAGAGGAGCTGCTCCCAGCCATCCACGGCGTGA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T84486-Ab | Anti-OXYR/ OTR/ OXTR monoclonal antibody |
Target Antigen | GM-Tg-g-T84486-Ag | OTR/OXTR VLP (virus-like particle) |
ORF Viral Vector | pGMLP003633 | Human OXTR Lentivirus plasmid |
ORF Viral Vector | vGMLP003633 | Human OXTR Lentivirus particle |
Target information
Target ID | GM-T84486 |
Target Name | OTR |
Gene ID | 5021, 18430, 702048, 25342, 101081711, 484670, 281371, 106781784 |
Gene Symbol and Synonyms | OT-R,OTR,OTR1,OXTR |
Uniprot Accession | P30559 |
Uniprot Entry Name | OXYR_HUMAN |
Protein Sub-location | Transmembrane Protein |
Category | Therapeutics Target |
Disease | Not Available |
Gene Ensembl | ENSG00000180914 |
Target Classification | GPCR |
The protein encoded by this gene belongs to the G-protein coupled receptor family and acts as a receptor for oxytocin. Its activity is mediated by G proteins which activate a phosphatidylinositol-calcium second messenger system. The oxytocin-oxytocin receptor system plays an important role in the uterus during parturition. [provided by RefSeq, Jul 2008]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.