Human OXTR/OT-R ORF/cDNA clone-Lentivirus particle (NM_000916)

Pre-made Human OXTR/OT-R Lentiviral expression plasmid for OXTR lentivirus packaging, OXTR lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collectionGo to OTR/OXTR/OT-R products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP003633 Human OXTR Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP003633
Gene Name OXTR
Accession Number NM_000916
Gene ID 5021
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 1170 bp
Gene Alias OT-R
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGGAGGGCGCGCTCGCAGCCAACTGGAGCGCCGAGGCAGCCAACGCCAGCGCCGCGCCGCCGGGGGCCGAGGGCAACCGCACCGCCGGACCCCCGCGGCGCAACGAGGCCCTGGCGCGCGTGGAGGTGGCGGTGCTGTGTCTCATCCTGCTCCTGGCGCTGAGCGGGAACGCGTGTGTGCTGCTGGCGCTGCGCACCACACGCCAGAAGCACTCGCGCCTCTTCTTCTTCATGAAGCACCTAAGCATCGCCGACCTGGTGGTGGCAGTGTTTCAGGTGCTGCCGCAGTTGCTGTGGGACATCACCTTCCGCTTCTACGGGCCCGACCTGCTGTGCCGCCTGGTCAAGTACTTGCAGGTGGTGGGCATGTTCGCCTCCACCTACCTGCTGCTGCTCATGTCCCTGGACCGCTGCCTGGCCATCTGCCAGCCGCTGCGCTCGCTGCGCCGCCGCACCGACCGCCTGGCAGTGCTCGCCACGTGGCTCGGCTGCCTGGTGGCCAGCGCGCCGCAGGTGCACATCTTCTCTCTGCGCGAGGTGGCTGACGGCGTCTTCGACTGCTGGGCCGTCTTCATCCAGCCCTGGGGACCCAAGGCCTACATCACATGGATCACGCTAGCTGTCTACATCGTGCCGGTCATCGTGCTCGCTGCCTGCTACGGCCTTATCAGCTTCAAGATCTGGCAGAACTTGCGGCTCAAGACCGCTGCAGCGGCGGCGGCCGAGGCGCCAGAGGGCGCGGCGGCTGGCGATGGGGGGCGCGTGGCCCTGGCGCGTGTCAGCAGCGTCAAGCTCATCTCCAAGGCCAAGATCCGCACGGTCAAGATGACTTTCATCATCGTGCTGGCCTTCATCGTGTGCTGGACGCCTTTCTTCTTCGTGCAGATGTGGAGCGTCTGGGATGCCAACGCGCCCAAGGAAGCCTCGGCCTTCATCATCGTCATGCTCCTGGCCAGCCTCAACAGCTGCTGCAACCCCTGGATCTACATGCTGTTCACGGGCCACCTCTTCCACGAACTCGTGCAGCGCTTCCTGTGCTGCTCCGCCAGCTACCTGAAGGGCAGACGCCTGGGAGAGACGAGTGCCAGCAAAAAGAGCAACTCGTCCTCCTTTGTCCTGAGCCATCGCAGCTCCAGCCAGAGGAGCTGCTCCCAGCCATCCACGGCGTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T84486-Ab Anti-OXYR/ OTR/ OXTR monoclonal antibody
    Target Antigen GM-Tg-g-T84486-Ag OTR/OXTR VLP (virus-like particle)
    ORF Viral Vector pGMLP003633 Human OXTR Lentivirus plasmid
    ORF Viral Vector vGMLP003633 Human OXTR Lentivirus particle


    Target information

    Target ID GM-T84486
    Target Name OTR
    Gene ID 5021, 18430, 702048, 25342, 101081711, 484670, 281371, 106781784
    Gene Symbol and Synonyms OT-R,OTR,OTR1,OXTR
    Uniprot Accession P30559
    Uniprot Entry Name OXYR_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target
    Disease Not Available
    Gene Ensembl ENSG00000180914
    Target Classification GPCR

    The protein encoded by this gene belongs to the G-protein coupled receptor family and acts as a receptor for oxytocin. Its activity is mediated by G proteins which activate a phosphatidylinositol-calcium second messenger system. The oxytocin-oxytocin receptor system plays an important role in the uterus during parturition. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.