Human KCNK3/K2p3.1/OAT1 ORF/cDNA clone-Lentivirus plasmid (NM_002246)
Cat. No.: pGMLP003639
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days
Pre-made Human KCNK3/K2p3.1/OAT1 Lentiviral expression plasmid for KCNK3 lentivirus packaging, KCNK3 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go to
TASK1/KCNK3/K2p3.1 products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product Description
Catalog ID | pGMLP003639 |
Gene Name | KCNK3 |
Accession Number | NM_002246 |
Gene ID | 3777 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 1185 bp |
Gene Alias | K2p3.1,OAT1,PPH4,TASK,TASK-1,TBAK1 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
ORF Nucleotide Sequence | ATGAAGCGGCAGAACGTGCGCACGCTGGCGCTCATCGTGTGCACCTTCACCTACCTGCTGGTGGGCGCCGCGGTCTTCGACGCGCTGGAGTCGGAGCCCGAGCTGATCGAGCGGCAGCGGCTGGAGCTGCGGCAGCAGGAGCTGCGGGCGCGCTACAACCTCAGCCAGGGCGGCTACGAGGAGCTGGAGCGCGTCGTGCTGCGCCTCAAGCCGCACAAGGCCGGCGTGCAGTGGCGCTTCGCCGGCTCCTTCTACTTCGCCATCACCGTCATCACCACCATCGGCTACGGGCACGCGGCACCCAGCACGGATGGCGGCAAGGTGTTCTGCATGTTCTACGCGCTGCTGGGCATCCCGCTCACGCTCGTCATGTTCCAGAGCCTGGGCGAGCGCATCAACACCTTGGTGAGGTACCTGCTGCACCGCGCCAAGAAGGGGCTGGGCATGCGGCGCGCCGACGTGTCCATGGCCAACATGGTGCTCATCGGCTTCTTCTCGTGCATCAGCACGCTGTGCATCGGCGCCGCCGCCTTCTCCCACTACGAGCACTGGACCTTCTTCCAGGCCTACTACTACTGCTTCATCACCCTCACCACCATCGGCTTCGGCGACTACGTGGCGCTGCAGAAGGACCAGGCCCTGCAGACGCAGCCGCAGTACGTGGCCTTCAGCTTCGTCTACATCCTTACGGGCCTCACGGTCATCGGCGCCTTCCTCAACCTCGTGGTGCTGCGCTTCATGACCATGAACGCCGAGGACGAGAAGCGCGACGCCGAGCACCGCGCGCTGCTCACGCGCAACGGGCAGGCGGGCGGCGGCGGAGGGGGTGGCAGCGCGCACACTACGGACACCGCCTCATCCACGGCGGCAGCGGGCGGCGGCGGCTTCCGCAACGTCTACGCGGAGGTGCTGCACTTCCAGTCCATGTGCTCGTGCCTGTGGTACAAGAGCCGCGAGAAGCTGCAGTACTCCATCCCCATGATCATCCCGCGGGACCTCTCCACGTCCGACACGTGCGTGGAGCAGAGCCACTCGTCGCCGGGAGGGGGCGGCCGCTACAGCGACACGCCCTCGCGACGCTGCCTGTGCAGCGGGGCGCCACGCTCCGCCATCAGCTCGGTGTCCACGGGTCTGCACAGCCTGTCCACCTTCCGCGGCCTCATGAAGCGCAGGAGCTCCGTGTGA |
ORF Protein Sequence | MKRQNVRTLALIVCTFTYLLVGAAVFDALESEPELIERQRLELRQQELRARYNLSQGGYEELERVVLRLKPHKAGVQWRFAGSFYFAITVITTIGYGHAAPSTDGGKVFCMFYALLGIPLTLVMFQSLGERINTLVRYLLHRAKKGLGMRRADVSMANMVLIGFFSCISTLCIGAAAFSHYEHWTFFQAYYYCFITLTTIGFGDYVALQKDQALQTQPQYVAFSFVYILTGLTVIGAFLNLVVLRFMTMNAEDEKRDAEHRALLTRNGQAGGGGGGGSAHTTDTASSTAAAGGGGFRNVYAEVLHFQSMCSCLWYKSREKLQYSIPMIIPRDLSTSDTCVEQSHSSPGGGGRYSDTPSRRCLCSGAPRSAISSVSTGLHSLSTFRGLMKRRSSV |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T15795-Ab | Anti-KCNK3/ TASK1/ K2p3.1 monoclonal antibody |
Target Antigen | GM-Tg-g-T15795-Ag | TASK1/KCNK3 VLP (virus-like particle) |
ORF Viral Vector | pGMLP003639 | Human KCNK3 Lentivirus plasmid |
ORF Viral Vector | vGMLP003639 | Human KCNK3 Lentivirus particle |
Target information
Target ID | GM-T15795 |
Target Name | TASK1 |
Gene ID | 3777, 16527, 699287, 29553, 101082745, 483002, 519188, 102150125 |
Gene Symbol and Synonyms | cTBAK-1,K2p3.1,KCNK3,OAT1,PPH4,rTASK,TASK,TASK-1,TASK1,TBAK1 |
Uniprot Accession | O14649 |
Uniprot Entry Name | KCNK3_HUMAN |
Protein Sub-location | Transmembrane Protein |
Category | Therapeutics Target |
Disease | Not Available |
Gene Ensembl | ENSG00000171303 |
Target Classification | Not Available |
This gene encodes a member of the superfamily of potassium channel proteins that contain two pore-forming P domains. The encoded protein is an outwardly rectifying channel that is sensitive to changes in extracellular pH and is inhibited by extracellular acidification. Also referred to as an acid-sensitive potassium channel, it is activated by the anesthetics halothane and isoflurane. Although three transcripts are detected in northern blots, there is currently no sequence available to confirm transcript variants for this gene. [provided by RefSeq, Aug 2008]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.