Human KCNK3/K2p3.1/OAT1 ORF/cDNA clone-Lentivirus particle (NM_002246)

Cat. No.: vGMLP003639

Pre-made Human KCNK3/K2p3.1/OAT1 Lentiviral expression plasmid for KCNK3 lentivirus packaging, KCNK3 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collection

Go to TASK1/KCNK3/K2p3.1 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

pdf MSDS
pdf Datasheet

Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP003639 Human KCNK3 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP003639
Gene Name KCNK3
Accession Number NM_002246
Gene ID 3777
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 1185 bp
Gene Alias K2p3.1,OAT1,PPH4,TASK,TASK-1,TBAK1
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGAAGCGGCAGAACGTGCGCACGCTGGCGCTCATCGTGTGCACCTTCACCTACCTGCTGGTGGGCGCCGCGGTCTTCGACGCGCTGGAGTCGGAGCCCGAGCTGATCGAGCGGCAGCGGCTGGAGCTGCGGCAGCAGGAGCTGCGGGCGCGCTACAACCTCAGCCAGGGCGGCTACGAGGAGCTGGAGCGCGTCGTGCTGCGCCTCAAGCCGCACAAGGCCGGCGTGCAGTGGCGCTTCGCCGGCTCCTTCTACTTCGCCATCACCGTCATCACCACCATCGGCTACGGGCACGCGGCACCCAGCACGGATGGCGGCAAGGTGTTCTGCATGTTCTACGCGCTGCTGGGCATCCCGCTCACGCTCGTCATGTTCCAGAGCCTGGGCGAGCGCATCAACACCTTGGTGAGGTACCTGCTGCACCGCGCCAAGAAGGGGCTGGGCATGCGGCGCGCCGACGTGTCCATGGCCAACATGGTGCTCATCGGCTTCTTCTCGTGCATCAGCACGCTGTGCATCGGCGCCGCCGCCTTCTCCCACTACGAGCACTGGACCTTCTTCCAGGCCTACTACTACTGCTTCATCACCCTCACCACCATCGGCTTCGGCGACTACGTGGCGCTGCAGAAGGACCAGGCCCTGCAGACGCAGCCGCAGTACGTGGCCTTCAGCTTCGTCTACATCCTTACGGGCCTCACGGTCATCGGCGCCTTCCTCAACCTCGTGGTGCTGCGCTTCATGACCATGAACGCCGAGGACGAGAAGCGCGACGCCGAGCACCGCGCGCTGCTCACGCGCAACGGGCAGGCGGGCGGCGGCGGAGGGGGTGGCAGCGCGCACACTACGGACACCGCCTCATCCACGGCGGCAGCGGGCGGCGGCGGCTTCCGCAACGTCTACGCGGAGGTGCTGCACTTCCAGTCCATGTGCTCGTGCCTGTGGTACAAGAGCCGCGAGAAGCTGCAGTACTCCATCCCCATGATCATCCCGCGGGACCTCTCCACGTCCGACACGTGCGTGGAGCAGAGCCACTCGTCGCCGGGAGGGGGCGGCCGCTACAGCGACACGCCCTCGCGACGCTGCCTGTGCAGCGGGGCGCCACGCTCCGCCATCAGCTCGGTGTCCACGGGTCTGCACAGCCTGTCCACCTTCCGCGGCCTCATGAAGCGCAGGAGCTCCGTGTGA
ORF Protein Sequence MKRQNVRTLALIVCTFTYLLVGAAVFDALESEPELIERQRLELRQQELRARYNLSQGGYEELERVVLRLKPHKAGVQWRFAGSFYFAITVITTIGYGHAAPSTDGGKVFCMFYALLGIPLTLVMFQSLGERINTLVRYLLHRAKKGLGMRRADVSMANMVLIGFFSCISTLCIGAAAFSHYEHWTFFQAYYYCFITLTTIGFGDYVALQKDQALQTQPQYVAFSFVYILTGLTVIGAFLNLVVLRFMTMNAEDEKRDAEHRALLTRNGQAGGGGGGGSAHTTDTASSTAAAGGGGFRNVYAEVLHFQSMCSCLWYKSREKLQYSIPMIIPRDLSTSDTCVEQSHSSPGGGGRYSDTPSRRCLCSGAPRSAISSVSTGLHSLSTFRGLMKRRSSV

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T15795-Ab Anti-KCNK3/ TASK1/ K2p3.1 monoclonal antibody
    Target Antigen GM-Tg-g-T15795-Ag TASK1/KCNK3 VLP (virus-like particle)
    ORF Viral Vector pGMLP003639 Human KCNK3 Lentivirus plasmid
    ORF Viral Vector vGMLP003639 Human KCNK3 Lentivirus particle


    Target information

    Target ID GM-T15795
    Target Name TASK1
    Gene ID 3777, 16527, 699287, 29553, 101082745, 483002, 519188, 102150125
    Gene Symbol and Synonyms cTBAK-1,K2p3.1,KCNK3,OAT1,PPH4,rTASK,TASK,TASK-1,TASK1,TBAK1
    Uniprot Accession O14649
    Uniprot Entry Name KCNK3_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target
    Disease Not Available
    Gene Ensembl ENSG00000171303
    Target Classification Not Available

    This gene encodes a member of the superfamily of potassium channel proteins that contain two pore-forming P domains. The encoded protein is an outwardly rectifying channel that is sensitive to changes in extracellular pH and is inhibited by extracellular acidification. Also referred to as an acid-sensitive potassium channel, it is activated by the anesthetics halothane and isoflurane. Although three transcripts are detected in northern blots, there is currently no sequence available to confirm transcript variants for this gene. [provided by RefSeq, Aug 2008]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.