Human SSTR3/SS-3-R/SS3-R ORF/cDNA clone-Lentivirus plasmid (NM_001051)

Cat. No.: pGMLP003671
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human SSTR3/SS-3-R/SS3-R Lentiviral expression plasmid for SSTR3 lentivirus packaging, SSTR3 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.


Target products collection

Go to SSTR3/SS-3-R products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $651.96
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP003671
Gene Name SSTR3
Accession Number NM_001051
Gene ID 6753
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 1257 bp
Gene Alias SS-3-R,SS3-R,SS3R,SSR-28
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGACATGCTTCATCCATCATCGGTGTCCACGACCTCAGAACCTGAGAATGCCTCCTCGGCCTGGCCCCCAGATGCCACCCTGGGCAACGTGTCGGCGGGCCCAAGCCCGGCAGGGCTGGCCGTCAGTGGCGTTCTGATCCCCCTGGTCTACCTGGTGGTGTGCGTGGTGGGCCTGCTGGGTAACTCGCTGGTCATCTATGTGGTCCTGCGGCACACGGCCAGCCCTTCAGTCACCAACGTCTACATCCTCAACCTGGCGCTGGCCGACGAGCTCTTCATGCTGGGGCTGCCCTTCCTGGCCGCCCAGAACGCCCTGTCCTACTGGCCCTTCGGCTCCCTCATGTGCCGCCTGGTCATGGCGGTGGATGGCATCAACCAGTTCACCAGCATATTCTGCCTGACTGTCATGAGCGTGGACCGCTACCTGGCCGTGGTACATCCCACCCGCTCGGCCCGCTGGCGCACAGCTCCGGTGGCCCGCACGGTCAGCGCGGCTGTGTGGGTGGCCTCAGCCGTGGTGGTGCTGCCCGTGGTGGTCTTCTCGGGAGTGCCCCGCGGCATGAGCACCTGCCACATGCAGTGGCCCGAGCCGGCGGCGGCCTGGCGAGCCGGCTTCATCATCTACACGGCCGCACTGGGCTTCTTCGGGCCGCTGCTGGTCATCTGCCTCTGCTACCTGCTCATCGTGGTGAAGGTGCGCTCAGCTGGGCGCCGGGTGTGGGCACCCTCGTGCCAGCGGCGGCGGCGCTCCGAACGCAGGGTCACGCGCATGGTGGTGGCCGTGGTGGCGCTCTTCGTGCTCTGCTGGATGCCCTTCTACGTGCTCAACATCGTCAACGTGGTGTGCCCACTGCCCGAGGAGCCTGCCTTCTTTGGGCTCTACTTCCTGGTGGTGGCGCTGCCCTATGCCAACAGCTGTGCCAACCCCATCCTTTATGGCTTCCTCTCCTACCGCTTCAAGCAGGGCTTCCGCAGGGTCCTGCTGCGGCCCTCCCGCCGTGTGCGCAGCCAGGAGCCCACTGTGGGGCCCCCGGAGAAGACTGAGGAGGAGGATGAGGAGGAGGAGGATGGGGAGGAGAGCAGGGAGGGGGGCAAGGGGAAGGAGATGAACGGCCGGGTCAGCCAGATCACGCAGCCTGGCACCAGCGGGCAGGAGCGGCCGCCCAGCAGAGTGGCCAGCAAGGAGCAGCAGCTCCTACCCCAAGAGGCTTCCACTGGGGAGAAGTCCAGCACGATGCGCATCAGCTACCTGTAG
ORF Protein Sequence MDMLHPSSVSTTSEPENASSAWPPDATLGNVSAGPSPAGLAVSGVLIPLVYLVVCVVGLLGNSLVIYVVLRHTASPSVTNVYILNLALADELFMLGLPFLAAQNALSYWPFGSLMCRLVMAVDGINQFTSIFCLTVMSVDRYLAVVHPTRSARWRTAPVARTVSAAVWVASAVVVLPVVVFSGVPRGMSTCHMQWPEPAAAWRAGFIIYTAALGFFGPLLVICLCYLLIVVKVRSAGRRVWAPSCQRRRRSERRVTRMVVAVVALFVLCWMPFYVLNIVNVVCPLPEEPAFFGLYFLVVALPYANSCANPILYGFLSYRFKQGFRRVLLRPSRRVRSQEPTVGPPEKTEEEDEEEEDGEESREGGKGKEMNGRVSQITQPGTSGQERPPSRVASKEQQLLPQEASTGEKSSTMRISYL

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T13644-Ab Anti-SSR3/ SSTR3/ SS-3-R monoclonal antibody
    Target Antigen GM-Tg-g-T13644-Ag SSTR3 VLP (virus-like particle)
    ORF Viral Vector pGMLP003671 Human SSTR3 Lentivirus plasmid
    ORF Viral Vector vGMLP003671 Human SSTR3 Lentivirus particle


    Target information

    Target ID GM-T13644
    Target Name SSTR3
    Gene ID 6753, 20607, 696585, 171044, 101096494, 481272, 518585, 100069706
    Gene Symbol and Synonyms Smstr-3,Smstr28,Smstr3,SS-3-R,SS3-R,SS3R,SSR-28,SST3,SSTR,SSTR3
    Uniprot Accession P32745
    Uniprot Entry Name SSR3_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target
    Disease Not Available
    Gene Ensembl ENSG00000278195
    Target Classification GPCR

    This gene encodes a member of the somatostatin receptor protein family. Somatostatins are peptide hormones that regulate diverse cellular functions such as neurotransmission, cell proliferation, and endocrine signaling as well as inhibiting the release of many hormones and other secretory proteins. Somatostatin has two active forms of 14 and 28 amino acids. The biological effects of somatostatins are mediated by a family of G-protein coupled somatostatin receptors that are expressed in a tissue-specific manner. Somatostatin receptors form homodimers and heterodimers with other members of the superfamily as well as with other G-protein coupled receptors and receptor tyrosine kinases. This protein is functionally coupled to adenylyl cyclase. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.