Human SSTR3/SS-3-R/ SS3-R ORF/cDNA clone-Lentivirus plasmid (NM_001051)
Pre-made Human SSTR3/SS-3-R/ SS3-R Lentiviral expression plasmid for SSTR3 lentivirus packaging, SSTR3 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go
to SSTR3/SS-3-R products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Plasmid Grade | Plasmid quantity |
---|---|---|---|
pGMLP003671 | Human SSTR3 Lentivirus plasmid | Research Grade | 10mg, 50mg, 100mg, 500mg, >1g |
GMP-like Grade | 10mg, 50mg, 100mg, 500mg, >1g | ||
High Quality (HQ) Grade | |||
Seed | 5ug |
Product Description
Catalog ID | pGMLP003671 |
Gene Name | SSTR3 |
Accession Number | NM_001051 |
Gene ID | 6753 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 1257 bp |
Gene Alias | SS-3-R, SS3-R, SS3R, SSR-28 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGGACATGCTTCATCCATCATCGGTGTCCACGACCTCAGAACCTGAGAATGCCTCCTCGGCCTGGCCCCCAGATGCCACCCTGGGCAACGTGTCGGCGGGCCCAAGCCCGGCAGGGCTGGCCGTCAGTGGCGTTCTGATCCCCCTGGTCTACCTGGTGGTGTGCGTGGTGGGCCTGCTGGGTAACTCGCTGGTCATCTATGTGGTCCTGCGGCACACGGCCAGCCCTTCAGTCACCAACGTCTACATCCTCAACCTGGCGCTGGCCGACGAGCTCTTCATGCTGGGGCTGCCCTTCCTGGCCGCCCAGAACGCCCTGTCCTACTGGCCCTTCGGCTCCCTCATGTGCCGCCTGGTCATGGCGGTGGATGGCATCAACCAGTTCACCAGCATATTCTGCCTGACTGTCATGAGCGTGGACCGCTACCTGGCCGTGGTACATCCCACCCGCTCGGCCCGCTGGCGCACAGCTCCGGTGGCCCGCACGGTCAGCGCGGCTGTGTGGGTGGCCTCAGCCGTGGTGGTGCTGCCCGTGGTGGTCTTCTCGGGAGTGCCCCGCGGCATGAGCACCTGCCACATGCAGTGGCCCGAGCCGGCGGCGGCCTGGCGAGCCGGCTTCATCATCTACACGGCCGCACTGGGCTTCTTCGGGCCGCTGCTGGTCATCTGCCTCTGCTACCTGCTCATCGTGGTGAAGGTGCGCTCAGCTGGGCGCCGGGTGTGGGCACCCTCGTGCCAGCGGCGGCGGCGCTCCGAACGCAGGGTCACGCGCATGGTGGTGGCCGTGGTGGCGCTCTTCGTGCTCTGCTGGATGCCCTTCTACGTGCTCAACATCGTCAACGTGGTGTGCCCACTGCCCGAGGAGCCTGCCTTCTTTGGGCTCTACTTCCTGGTGGTGGCGCTGCCCTATGCCAACAGCTGTGCCAACCCCATCCTTTATGGCTTCCTCTCCTACCGCTTCAAGCAGGGCTTCCGCAGGGTCCTGCTGCGGCCCTCCCGCCGTGTGCGCAGCCAGGAGCCCACTGTGGGGCCCCCGGAGAAGACTGAGGAGGAGGATGAGGAGGAGGAGGATGGGGAGGAGAGCAGGGAGGGGGGCAAGGGGAAGGAGATGAACGGCCGGGTCAGCCAGATCACGCAGCCTGGCACCAGCGGGCAGGAGCGGCCGCCCAGCAGAGTGGCCAGCAAGGAGCAGCAGCTCCTACCCCAAGAGGCTTCCACTGGGGAGAAGTCCAGCACGATGCGCATCAGCTACCTGTAG |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T13644-Ab | Anti-SSR3/ SSTR3/ SS-3-R monoclonal antibody |
Target Antigen | GM-Tg-g-T13644-Ag | SSTR3 VLP (virus-like particle) |
ORF Viral Vector | pGMLP003671 | Human SSTR3 Lentivirus plasmid |
ORF Viral Vector | vGMLP003671 | Human SSTR3 Lentivirus particle |
Target information
Target ID | GM-T13644 |
Target Name | SSTR3 |
Gene ID | 6753, 20607, 696585, 171044, 101096494, 481272, 518585, 100069706 |
Gene Symbol and Synonyms | Smstr-3,Smstr28,Smstr3,SS-3-R,SS3-R,SS3R,SSR-28,SST3,SSTR,SSTR3 |
Uniprot Accession | P32745 |
Uniprot Entry Name | SSR3_HUMAN |
Protein Sub-location | Transmembrane Protein |
Category | Therapeutics Target |
Disease | Not Available |
Gene Ensembl | ENSG00000278195 |
Target Classification | GPCR |
This gene encodes a member of the somatostatin receptor protein family. Somatostatins are peptide hormones that regulate diverse cellular functions such as neurotransmission, cell proliferation, and endocrine signaling as well as inhibiting the release of many hormones and other secretory proteins. Somatostatin has two active forms of 14 and 28 amino acids. The biological effects of somatostatins are mediated by a family of G-protein coupled somatostatin receptors that are expressed in a tissue-specific manner. Somatostatin receptors form homodimers and heterodimers with other members of the superfamily as well as with other G-protein coupled receptors and receptor tyrosine kinases. This protein is functionally coupled to adenylyl cyclase. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.