Human SLC22A18/BWR1A/BWSCR1A ORF/cDNA clone-Lentivirus plasmid (NM_002555)
Cat. No.: pGMLP003680
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days
Pre-made Human SLC22A18/BWR1A/BWSCR1A Lentiviral expression plasmid for SLC22A18 lentivirus packaging, SLC22A18 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go to
SLC22A18/BWR1A products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product Description
Catalog ID | pGMLP003680 |
Gene Name | SLC22A18 |
Accession Number | NM_002555 |
Gene ID | 5002 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 1275 bp |
Gene Alias | BWR1A,BWSCR1A,HET,IMPT1,ITM,ORCTL2,p45-BWR1A,SLC22A1L,TSSC5 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
ORF Nucleotide Sequence | ATGCAGGGAGCTCGGGCTCCCAGGGACCAGGGCCGGTCCCCCGGCAGGATGAGCGCTCTAGGCCGGTCCTCGGTCATCTTGCTTACCTACGTGCTGGCCGCCACAGAACTTACCTGCCTCTTCATGCAGTTCTCCATCGTGCCATACCTGTCTCGGAAACTGGGCCTGGATTCCATTGCCTTCGGCTACCTGCAAACCACCTTCGGGGTGCTGCAGCTGCTGGGCGGGCCGGTATTTGGCAGGTTCGCAGACCAGCGCGGGGCGCGGGCGGCGCTCACGCTCTCCTTCCTGGCTGCCTTGGCGCTCTACCTGCTCCTGGCGGCCGCCTCCAGCCCGGCCCTGCCCGGGGTCTACCTGCTCTTCGCCTCGCGCCTGCCCGGAGCGCTCATGCACACGCTGCCAGCCGCCCAGATGGTCATCACGGACCTGTCGGCACCCGAGGAGCGGCCCGCGGCCCTGGGCCGGCTGGGCCTCTGCTTCGGCGTCGGAGTCATCCTCGGCTCCCTGCTGGGCGGGACCCTGGTCTCCGCGTACGGGATTCAGTGCCCGGCCATCCTGGCTGCCCTGGCCACCCTCCTGGGAGCTGTCCTCAGCTTCACCTGCATCCCCGCCAGCACCAAAGGGGCCAAAACTGACGCCCAGGCTCCACTGCCAGGCGGCCCCCGGGCCAGTGTGTTCGACCTGAAGGCCATCGCCTCCCTGCTGCGGCTGCCAGACGTCCCGAGGATCTTCCTGGTGAAGGTGGCCTCCAACTGCCCCACAGGGCTCTTCATGGTCATGTTCTCCATCATCTCCATGGACTTCTTCCAGCTGGAGGCCGCCCAAGCTGGCTACCTCATGTCCTTCTTCGGGCTCCTCCAGATGGTGACCCAGGGCCTGGTCATCGGGCAGCTGAGCAGCCACTTCTCGGAGGAGGTGCTGCTCCGGGCCAGCGTGCTGGTCTTCATCGTGGTGGGCCTGGCCATGGCCTGGATGTCCAGCGTCTTCCACTTCTGCCTCCTGGTGCCCGGCCTGGTGTTCAGCCTCTGCACCCTCAACGTGGTCACCGACAGCATGCTGATCAAGGCTGTCTCCACCTCGGACACAGGGACCATGCTGGGCCTCTGCGCCTCTGTACAACCACTGCTCCGAACTCTGGGACCCACGGTCGGCGGCCTCCTGTACCGCAGCTTTGGCGTCCCCGTCTTCGGCCACGTGCAGGTTGCTATCAATACCCTTGTCCTCCTGGTCCTCTGGAGGAAACCTATGCCCCAGAGGAAGGACAAAGTCCGGTGA |
ORF Protein Sequence | MQGARAPRDQGRSPGRMSALGRSSVILLTYVLAATELTCLFMQFSIVPYLSRKLGLDSIAFGYLQTTFGVLQLLGGPVFGRFADQRGARAALTLSFLAALALYLLLAAASSPALPGVYLLFASRLPGALMHTLPAAQMVITDLSAPEERPAALGRLGLCFGVGVILGSLLGGTLVSAYGIQCPAILAALATLLGAVLSFTCIPASTKGAKTDAQAPLPGGPRASVFDLKAIASLLRLPDVPRIFLVKVASNCPTGLFMVMFSIISMDFFQLEAAQAGYLMSFFGLLQMVTQGLVIGQLSSHFSEEVLLRASVLVFIVVGLAMAWMSSVFHFCLLVPGLVFSLCTLNVVTDSMLIKAVSTSDTGTMLGLCASVQPLLRTLGPTVGGLLYRSFGVPVFGHVQVAINTLVLLVLWRKPMPQRKDKVR |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-MP1560-Ab | Anti-S22AI/ SLC22A18/ BWR1A monoclonal antibody |
Target Antigen | GM-Tg-g-MP1560-Ag | SLC22A18 VLP (virus-like particle) |
ORF Viral Vector | pGMLP003680 | Human SLC22A18 Lentivirus plasmid |
ORF Viral Vector | vGMLP003680 | Human SLC22A18 Lentivirus particle |
Target information
Target ID | GM-MP1560 |
Target Name | SLC22A18 |
Gene ID | 5002, 18400, 721230, 309131, 101092398, 475997, 504885, 100060198 |
Gene Symbol and Synonyms | BWR1A,BWSCR1A,HET,IMPT1,ITM,ORCTL2,p45-BWR1A,SLC22A18,SLC22A1L,TSSC5 |
Uniprot Accession | Q96BI1 |
Uniprot Entry Name | S22AI_HUMAN |
Protein Sub-location | Transmembrane Protein |
Category | Not Available |
Disease | Cancer |
Gene Ensembl | ENSG00000110628 |
Target Classification | Tumor-associated antigen (TAA) |
This gene is one of several tumor-suppressing subtransferable fragments located in the imprinted gene domain of 11p15.5, an important tumor-suppressor gene region. Alterations in this region have been associated with the Beckwith-Wiedemann syndrome, Wilms tumor, rhabdomyosarcoma, adrenocortical carcinoma, and lung, ovarian, and breast cancer. This gene is imprinted, with preferential expression from the maternal allele. Mutations in this gene have been found in Wilms' tumor and lung cancer. This protein may act as a transporter of organic cations, and have a role in the transport of chloroquine and quinidine-related compounds in kidney. Several alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Oct 2015]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.