Human HRH1/H1-R/ H1R ORF/cDNA clone-Lentivirus plasmid (NM_001098213)
Pre-made Human HRH1/H1-R/ H1R Lentiviral expression plasmid for HRH1 lentivirus packaging, HRH1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go
to H1R/HRH1/H1-R products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Plasmid Grade | Plasmid quantity |
---|---|---|---|
pGMLP003757 | Human HRH1 Lentivirus plasmid | Research Grade | 10mg, 50mg, 100mg, 500mg, >1g |
GMP-like Grade | 10mg, 50mg, 100mg, 500mg, >1g | ||
High Quality (HQ) Grade | |||
Seed | 5ug |
Product Description
Catalog ID | pGMLP003757 |
Gene Name | HRH1 |
Accession Number | NM_001098213 |
Gene ID | 3269 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 1464 bp |
Gene Alias | H1-R, H1R, HH1R, hisH1 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGAGCCTCCCCAATTCCTCCTGCCTCTTAGAAGACAAGATGTGTGAGGGCAACAAGACCACTATGGCCAGCCCCCAGCTGATGCCCCTGGTGGTGGTCCTGAGCACTATCTGCTTGGTCACAGTAGGGCTCAACCTGCTGGTGCTGTATGCCGTACGGAGTGAGCGGAAGCTCCACACTGTGGGGAACCTGTACATCGTCAGCCTCTCGGTGGCGGACTTGATCGTGGGTGCCGTCGTCATGCCTATGAACATCCTCTACCTGCTCATGTCCAAGTGGTCACTGGGCCGTCCTCTCTGCCTCTTTTGGCTTTCCATGGACTATGTGGCCAGCACAGCGTCCATTTTCAGTGTCTTCATCCTGTGCATTGATCGCTACCGCTCTGTCCAGCAGCCCCTCAGGTACCTTAAGTATCGTACCAAGACCCGAGCCTCGGCCACCATTCTGGGGGCCTGGTTTCTCTCTTTTCTGTGGGTTATTCCCATTCTAGGCTGGAATCACTTCATGCAGCAGACCTCGGTGCGCCGAGAGGACAAGTGTGAGACAGACTTCTATGATGTCACCTGGTTCAAGGTCATGACTGCCATCATCAACTTCTACCTGCCCACCTTGCTCATGCTCTGGTTCTATGCCAAGATCTACAAGGCCGTACGACAACACTGCCAGCACCGGGAGCTCATCAATAGGTCCCTCCCTTCCTTCTCAGAAATTAAGCTGAGGCCAGAGAACCCCAAGGGGGATGCCAAGAAACCAGGGAAGGAGTCTCCCTGGGAGGTTCTGAAAAGGAAGCCAAAAGATGCTGGTGGTGGATCTGTCTTGAAGTCACCATCCCAAACCCCCAAGGAGATGAAATCCCCAGTTGTCTTCAGCCAAGAGGATGATAGAGAAGTAGACAAACTCTACTGCTTTCCACTTGATATTGTGCACATGCAGGCTGCGGCAGAGGGGAGTAGCAGGGACTATGTAGCCGTCAACCGGAGCCATGGCCAGCTCAAGACAGATGAGCAGGGCCTGAACACACATGGGGCCAGCGAGATATCAGAGGATCAGATGTTAGGTGATAGCCAATCCTTCTCTCGAACGGACTCAGATACCACCACAGAGACAGCACCAGGCAAAGGCAAATTGAGGAGTGGGTCTAACACAGGCCTGGATTACATCAAGTTTACTTGGAAGAGGCTCCGCTCGCATTCAAGACAGTATGTATCTGGGTTGCACATGAACCGCGAAAGGAAGGCCGCCAAACAGTTGGGTTTTATCATGGCAGCCTTCATCCTCTGCTGGATCCCTTATTTCATCTTCTTCATGGTCATTGCCTTCTGCAAGAACTGTTGCAATGAACATTTGCACATGTTCACCATCTGGCTGGGCTACATCAACTCCACACTGAACCCCCTCATCTACCCCTTGTGCAATGAGAACTTCAAGAAGACATTCAAGAGAATTCTGCATATTCGCTCCTAA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T77913-Ab | Anti-HRH1/ H1R/ H1-R monoclonal antibody |
Target Antigen | GM-Tg-g-T77913-Ag | H1R/HRH1 VLP (virus-like particle) |
ORF Viral Vector | pGMLP003757 | Human HRH1 Lentivirus plasmid |
ORF Viral Vector | vGMLP003757 | Human HRH1 Lentivirus particle |
Target information
Target ID | GM-T77913 |
Target Name | H1R |
Gene ID | 3269, 15465, 696359, 24448, 101088314, 403813, 281231, 100034110 |
Gene Symbol and Synonyms | Bphs,H1,H1-R,H1R,HH1R,Hir,hisH1,Hisr,HRH1 |
Uniprot Accession | P35367 |
Uniprot Entry Name | HRH1_HUMAN |
Protein Sub-location | Transmembrane Protein |
Category | Therapeutics Target |
Disease | Not Available |
Gene Ensembl | ENSG00000196639 |
Target Classification | GPCR |
Histamine is a ubiquitous messenger molecule released from mast cells, enterochromaffin-like cells, and neurons. Its various actions are mediated by histamine receptors H1, H2, H3 and H4. The protein encoded by this gene is an integral membrane protein and belongs to the G protein-coupled receptor superfamily. It mediates the contraction of smooth muscles, the increase in capillary permeability due to contraction of terminal venules, the release of catecholamine from adrenal medulla, and neurotransmission in the central nervous system. It has been associated with multiple processes, including memory and learning, circadian rhythm, and thermoregulation. It is also known to contribute to the pathophysiology of allergic diseases such as atopic dermatitis, asthma, anaphylaxis and allergic rhinitis. Multiple alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Jan 2015]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.