Human FFAR1/FFA1R/ GPCR40 ORF/cDNA clone-Lentivirus plasmid (NM_005303)

Pre-made Human FFAR1/FFA1R/ GPCR40 Lentiviral expression plasmid for FFAR1 lentivirus packaging, FFAR1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

Target products collectionGo to GPR40/FFAR1/FFA1R products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMLP003785 Human FFAR1 Lentivirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMLP003785
Gene Name FFAR1
Accession Number NM_005303
Gene ID 2864
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 903 bp
Gene Alias FFA1R, GPCR40, GPR40
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGGACCTGCCCCCGCAGCTCTCCTTCGGCCTCTATGTGGCCGCCTTTGCGCTGGGCTTCCCGCTCAACGTCCTGGCCATCCGAGGCGCGACGGCCCACGCCCGGCTCCGTCTCACCCCTAGCCTGGTCTACGCCCTGAACCTGGGCTGCTCCGACCTGCTGCTGACAGTCTCTCTGCCCCTGAAGGCGGTGGAGGCGCTAGCCTCCGGGGCCTGGCCTCTGCCGGCCTCGCTGTGCCCCGTCTTCGCGGTGGCCCACTTCTTCCCACTCTATGCCGGCGGGGGCTTCCTGGCCGCCCTGAGTGCAGGCCGCTACCTGGGAGCAGCCTTCCCCTTGGGCTACCAAGCCTTCCGGAGGCCGTGCTATTCCTGGGGGGTGTGCGCGGCCATCTGGGCCCTCGTCCTGTGTCACCTGGGTCTGGTCTTTGGGTTGGAGGCTCCAGGAGGCTGGCTGGACCACAGCAACACCTCCCTGGGCATCAACACACCGGTCAACGGCTCTCCGGTCTGCCTGGAGGCCTGGGACCCGGCCTCTGCCGGCCCGGCCCGCTTCAGCCTCTCTCTCCTGCTCTTTTTTCTGCCCTTGGCCATCACAGCCTTCTGCTACGTGGGCTGCCTCCGGGCACTGGCCCGCTCCGGCCTGACGCACAGGCGGAAGCTGCGGGCCGCCTGGGTGGCCGGCGGGGCCCTCCTCACGCTGCTGCTCTGCGTAGGACCCTACAACGCCTCCAACGTGGCCAGCTTCCTGTACCCCAATCTAGGAGGCTCCTGGCGGAAGCTGGGGCTCATCACGGGTGCCTGGAGTGTGGTGCTTAATCCGCTGGTGACCGGTTACTTGGGAAGGGGTCCTGGCCTGAAGACAGTGTGTGCGGCAAGAACGCAAGGGGGCAAGTCCCAGAAGTAA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T25608-Ab Anti-FFAR1/ GPR40/ FFA1R monoclonal antibody
    Target Antigen GM-Tg-g-T25608-Ag GPR40/FFAR1 VLP (virus-like particle)
    ORF Viral Vector pGMLP003785 Human FFAR1 Lentivirus plasmid
    ORF Viral Vector vGMLP003785 Human FFAR1 Lentivirus particle


    Target information

    Target ID GM-T25608
    Target Name GPR40
    Gene ID 2864, 233081, 708620, 266607, 101101019, 612661, 618180, 100059338
    Gene Symbol and Synonyms FFA1R,FFAR1,GPCR40,GPR40
    Uniprot Accession O14842
    Uniprot Entry Name FFAR1_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target
    Disease Not Available
    Gene Ensembl ENSG00000126266
    Target Classification GPCR

    This gene encodes a member of the GP40 family of G protein-coupled receptors that are clustered together on chromosome 19. The encoded protein is a receptor for medium and long chain free fatty acids and may be involved in the metabolic regulation of insulin secretion. Polymorphisms in this gene may be associated with type 2 diabetes. [provided by RefSeq, Apr 2009]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.