Human FFAR1/FFA1R/ GPCR40 ORF/cDNA clone-Lentivirus plasmid (NM_005303)
Pre-made Human FFAR1/FFA1R/ GPCR40 Lentiviral expression plasmid for FFAR1 lentivirus packaging, FFAR1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go
to GPR40/FFAR1/FFA1R products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Plasmid Grade | Plasmid quantity |
---|---|---|---|
pGMLP003785 | Human FFAR1 Lentivirus plasmid | Research Grade | 10mg, 50mg, 100mg, 500mg, >1g |
GMP-like Grade | 10mg, 50mg, 100mg, 500mg, >1g | ||
High Quality (HQ) Grade | |||
Seed | 5ug |
Product Description
Catalog ID | pGMLP003785 |
Gene Name | FFAR1 |
Accession Number | NM_005303 |
Gene ID | 2864 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 903 bp |
Gene Alias | FFA1R, GPCR40, GPR40 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGGACCTGCCCCCGCAGCTCTCCTTCGGCCTCTATGTGGCCGCCTTTGCGCTGGGCTTCCCGCTCAACGTCCTGGCCATCCGAGGCGCGACGGCCCACGCCCGGCTCCGTCTCACCCCTAGCCTGGTCTACGCCCTGAACCTGGGCTGCTCCGACCTGCTGCTGACAGTCTCTCTGCCCCTGAAGGCGGTGGAGGCGCTAGCCTCCGGGGCCTGGCCTCTGCCGGCCTCGCTGTGCCCCGTCTTCGCGGTGGCCCACTTCTTCCCACTCTATGCCGGCGGGGGCTTCCTGGCCGCCCTGAGTGCAGGCCGCTACCTGGGAGCAGCCTTCCCCTTGGGCTACCAAGCCTTCCGGAGGCCGTGCTATTCCTGGGGGGTGTGCGCGGCCATCTGGGCCCTCGTCCTGTGTCACCTGGGTCTGGTCTTTGGGTTGGAGGCTCCAGGAGGCTGGCTGGACCACAGCAACACCTCCCTGGGCATCAACACACCGGTCAACGGCTCTCCGGTCTGCCTGGAGGCCTGGGACCCGGCCTCTGCCGGCCCGGCCCGCTTCAGCCTCTCTCTCCTGCTCTTTTTTCTGCCCTTGGCCATCACAGCCTTCTGCTACGTGGGCTGCCTCCGGGCACTGGCCCGCTCCGGCCTGACGCACAGGCGGAAGCTGCGGGCCGCCTGGGTGGCCGGCGGGGCCCTCCTCACGCTGCTGCTCTGCGTAGGACCCTACAACGCCTCCAACGTGGCCAGCTTCCTGTACCCCAATCTAGGAGGCTCCTGGCGGAAGCTGGGGCTCATCACGGGTGCCTGGAGTGTGGTGCTTAATCCGCTGGTGACCGGTTACTTGGGAAGGGGTCCTGGCCTGAAGACAGTGTGTGCGGCAAGAACGCAAGGGGGCAAGTCCCAGAAGTAA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T25608-Ab | Anti-FFAR1/ GPR40/ FFA1R monoclonal antibody |
Target Antigen | GM-Tg-g-T25608-Ag | GPR40/FFAR1 VLP (virus-like particle) |
ORF Viral Vector | pGMLP003785 | Human FFAR1 Lentivirus plasmid |
ORF Viral Vector | vGMLP003785 | Human FFAR1 Lentivirus particle |
Target information
Target ID | GM-T25608 |
Target Name | GPR40 |
Gene ID | 2864, 233081, 708620, 266607, 101101019, 612661, 618180, 100059338 |
Gene Symbol and Synonyms | FFA1R,FFAR1,GPCR40,GPR40 |
Uniprot Accession | O14842 |
Uniprot Entry Name | FFAR1_HUMAN |
Protein Sub-location | Transmembrane Protein |
Category | Therapeutics Target |
Disease | Not Available |
Gene Ensembl | ENSG00000126266 |
Target Classification | GPCR |
This gene encodes a member of the GP40 family of G protein-coupled receptors that are clustered together on chromosome 19. The encoded protein is a receptor for medium and long chain free fatty acids and may be involved in the metabolic regulation of insulin secretion. Polymorphisms in this gene may be associated with type 2 diabetes. [provided by RefSeq, Apr 2009]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.