Human WNT5A/hWNT5A ORF/cDNA clone-Lentivirus plasmid (NM_003392)
Pre-made Human WNT5A/hWNT5A Lentiviral expression plasmid for WNT5A lentivirus packaging, WNT5A lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go
to WNT5A/hWNT5A products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Plasmid Grade | Plasmid quantity |
---|---|---|---|
pGMLP003836 | Human WNT5A Lentivirus plasmid | Research Grade | 10mg, 50mg, 100mg, 500mg, >1g |
GMP-like Grade | 10mg, 50mg, 100mg, 500mg, >1g | ||
High Quality (HQ) Grade | |||
Seed | 5ug |
Product Description
Catalog ID | pGMLP003836 |
Gene Name | WNT5A |
Accession Number | NM_003392 |
Gene ID | 7474 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 1143 bp |
Gene Alias | hWNT5A |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGAAGAAGTCCATTGGAATATTAAGCCCAGGAGTTGCTTTGGGGATGGCTGGAAGTGCAATGTCTTCCAAGTTCTTCCTAGTGGCTTTGGCCATATTTTTCTCCTTCGCCCAGGTTGTAATTGAAGCCAATTCTTGGTGGTCGCTAGGTATGAATAACCCTGTTCAGATGTCAGAAGTATATATTATAGGAGCACAGCCTCTCTGCAGCCAACTGGCAGGACTTTCTCAAGGACAGAAGAAACTGTGCCACTTGTATCAGGACCACATGCAGTACATCGGAGAAGGCGCGAAGACAGGCATCAAAGAATGCCAGTATCAATTCCGACATCGAAGGTGGAACTGCAGCACTGTGGATAACACCTCTGTTTTTGGCAGGGTGATGCAGATAGGCAGCCGCGAGACGGCCTTCACATACGCGGTGAGCGCAGCAGGGGTGGTGAACGCCATGAGCCGGGCGTGCCGCGAGGGCGAGCTGTCCACCTGCGGCTGCAGCCGCGCCGCGCGCCCCAAGGACCTGCCGCGGGACTGGCTCTGGGGCGGCTGCGGCGACAACATCGACTATGGCTACCGCTTTGCCAAGGAGTTCGTGGACGCCCGCGAGCGGGAGCGCATCCACGCCAAGGGCTCCTACGAGAGTGCTCGCATCCTCATGAACCTGCACAACAACGAGGCCGGCCGCAGGACGGTGTACAACCTGGCTGATGTGGCCTGCAAGTGCCATGGGGTGTCCGGCTCATGTAGCCTGAAGACATGCTGGCTGCAGCTGGCAGACTTCCGCAAGGTGGGTGATGCCCTGAAGGAGAAGTACGACAGCGCGGCGGCCATGCGGCTCAACAGCCGGGGCAAGTTGGTACAGGTCAACAGCCGCTTCAACTCGCCCACCACACAAGACCTGGTCTACATCGACCCCAGCCCTGACTACTGCGTGCGCAATGAGAGCACCGGCTCGCTGGGCACGCAGGGCCGCCTGTGCAACAAGACGTCGGAGGGCATGGATGGCTGCGAGCTCATGTGCTGCGGCCGTGGCTACGACCAGTTCAAGACCGTGCAGACGGAGCGCTGCCACTGCAAGTTCCACTGGTGCTGCTACGTCAAGTGCAAGAAGTGCACGGAGATCGTGGACCAGTTTGTGTGCAAGTAG |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T13175-Ab | Anti-WNT5A/ hWNT5A monoclonal antibody |
Target Antigen | GM-Tg-g-T13175-Ag | WNT5A VLP (virus-like particle) |
Cytokine | cks-Tg-g-GM-T13175 | wingless-type MMTV integration site family, member 5A (WNT5A) protein & antibody |
ORF Viral Vector | pGMLP003836 | Human WNT5A Lentivirus plasmid |
ORF Viral Vector | pGMAP000537 | Human WNT5A Adenovirus plasmid |
ORF Viral Vector | vGMLP003836 | Human WNT5A Lentivirus particle |
ORF Viral Vector | vGMAP000537 | Human WNT5A Adenovirus particle |
Target information
Target ID | GM-T13175 |
Target Name | WNT5A |
Gene ID | 7474, 22418, 705692, 64566, 101080694, 484721, 530005, 100059157 |
Gene Symbol and Synonyms | 8030457G12Rik,hWNT5A,Wnt-5a,WNT5A |
Uniprot Accession | P41221 |
Uniprot Entry Name | WNT5A_HUMAN |
Protein Sub-location | Transmembrane Protein |
Category | Therapeutics Target, Cytokine Target |
Disease | Cancer |
Gene Ensembl | ENSG00000114251 |
Target Classification | Tumor-associated antigen (TAA) |
The WNT gene family consists of structurally related genes which encode secreted signaling proteins. These proteins have been implicated in oncogenesis and in several developmental processes, including regulation of cell fate and patterning during embryogenesis. This gene encodes a member of the WNT family that signals through both the canonical and non-canonical WNT pathways. This protein is a ligand for the seven transmembrane receptor frizzled-5 and the tyrosine kinase orphan receptor 2. This protein plays an essential role in regulating developmental pathways during embryogenesis. This protein may also play a role in oncogenesis. Mutations in this gene are the cause of autosomal dominant Robinow syndrome. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jan 2012]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.