Human MTNR1B/FGQTL2/ MEL-1B-R ORF/cDNA clone-Lentivirus plasmid (NM_005959)
Pre-made Human MTNR1B/FGQTL2/ MEL-1B-R Lentiviral expression plasmid for MTNR1B lentivirus packaging, MTNR1B lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go
to MTNR1B/FGQTL2 products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Plasmid Grade | Plasmid quantity |
---|---|---|---|
pGMLP003857 | Human MTNR1B Lentivirus plasmid | Research Grade | 10mg, 50mg, 100mg, 500mg, >1g |
GMP-like Grade | 10mg, 50mg, 100mg, 500mg, >1g | ||
High Quality (HQ) Grade | |||
Seed | 5ug |
Product Description
Catalog ID | pGMLP003857 |
Gene Name | MTNR1B |
Accession Number | NM_005959 |
Gene ID | 4544 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 1089 bp |
Gene Alias | FGQTL2, MEL-1B-R, MT2 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGTCAGAGAACGGCTCCTTCGCCAACTGCTGCGAGGCGGGCGGGTGGGCAGTGCGCCCGGGCTGGTCGGGGGCTGGCAGCGCGCGGCCCTCCAGGACCCCTCGACCTCCCTGGGTGGCTCCAGCGCTGTCCGCGGTGCTCATCGTCACCACCGCCGTGGACGTCGTGGGCAACCTCCTGGTGATCCTCTCCGTGCTCAGGAACCGCAAGCTCCGGAACGCAGGTAATTTGTTCTTGGTGAGTCTGGCATTGGCTGACCTGGTGGTGGCCTTCTACCCCTACCCGCTAATCCTCGTGGCCATCTTCTATGACGGCTGGGCCCTGGGGGAGGAGCACTGCAAGGCCAGCGCCTTTGTGATGGGCCTGAGCGTCATCGGCTCTGTCTTCAATATCACTGCCATCGCCATTAACCGCTACTGCTACATCTGCCACAGCATGGCCTACCACCGAATCTACCGGCGCTGGCACACCCCTCTGCACATCTGCCTCATCTGGCTCCTCACCGTGGTGGCCTTGCTGCCCAACTTCTTTGTGGGGTCCCTGGAGTACGACCCACGCATCTATTCCTGCACCTTCATCCAGACCGCCAGCACCCAGTACACGGCGGCAGTGGTGGTCATCCACTTCCTCCTCCCTATCGCTGTCGTGTCCTTCTGCTACCTGCGCATCTGGGTGCTGGTGCTTCAGGCCCGCAGGAAAGCCAAGCCAGAGAGCAGGCTGTGCCTGAAGCCCAGCGACTTGCGGAGCTTTCTAACCATGTTTGTGGTGTTTGTGATCTTTGCCATCTGCTGGGCTCCACTTAACTGCATCGGCCTCGCTGTGGCCATCAACCCCCAAGAAATGGCTCCCCAGATCCCTGAGGGGCTATTTGTCACTAGCTACTTACTGGCTTATTTCAACAGCTGCCTGAATGCCATTGTCTATGGGCTCTTGAACCAAAACTTCCGCAGGGAATACAAGAGGATCCTCTTGGCCCTTTGGAACCCACGGCACTGCATTCAAGATGCTTCCAAGGGCAGCCACGCGGAGGGGCTGCAGAGCCCAGCTCCACCCATCATTGGTGTGCAGCACCAGGCAGATGCTCTCTAG |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T48268-Ab | Anti-MTR1B/ MTNR1B/ FGQTL2 monoclonal antibody |
Target Antigen | GM-Tg-g-T48268-Ag | MTNR1B VLP (virus-like particle) |
ORF Viral Vector | pGMLP003857 | Human MTNR1B Lentivirus plasmid |
ORF Viral Vector | vGMLP003857 | Human MTNR1B Lentivirus particle |
Target information
Target ID | GM-T48268 |
Target Name | MTNR1B |
Gene ID | 4544, 244701, 695629, 192646, 101083701, 607818, 528665, 100059172 |
Gene Symbol and Synonyms | FGQTL2,MEL-1B-R,Mel1b,Mel1b-r,MT2,MTNR1B |
Uniprot Accession | P49286 |
Uniprot Entry Name | MTR1B_HUMAN |
Protein Sub-location | Transmembrane Protein |
Category | Therapeutics Target |
Disease | Not Available |
Gene Ensembl | ENSG00000134640 |
Target Classification | GPCR |
This gene encodes one of two high affinity forms of a receptor for melatonin, the primary hormone secreted by the pineal gland. This gene product is an integral membrane protein that is a G-protein coupled, 7-transmembrane receptor. It is found primarily in the retina and brain although this detection requires RT-PCR. It is thought to participate in light-dependent functions in the retina and may be involved in the neurobiological effects of melatonin. [provided by RefSeq, Jul 2008]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.