Human MTNR1B/FGQTL2/ MEL-1B-R ORF/cDNA clone-Lentivirus particle (NM_005959)

Pre-made Human MTNR1B/FGQTL2/ MEL-1B-R Lentiviral expression plasmid for MTNR1B lentivirus packaging, MTNR1B lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collectionGo to MTNR1B/FGQTL2 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP003857 Human MTNR1B Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP003857
Gene Name MTNR1B
Accession Number NM_005959
Gene ID 4544
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 1089 bp
Gene Alias FGQTL2, MEL-1B-R, MT2
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGTCAGAGAACGGCTCCTTCGCCAACTGCTGCGAGGCGGGCGGGTGGGCAGTGCGCCCGGGCTGGTCGGGGGCTGGCAGCGCGCGGCCCTCCAGGACCCCTCGACCTCCCTGGGTGGCTCCAGCGCTGTCCGCGGTGCTCATCGTCACCACCGCCGTGGACGTCGTGGGCAACCTCCTGGTGATCCTCTCCGTGCTCAGGAACCGCAAGCTCCGGAACGCAGGTAATTTGTTCTTGGTGAGTCTGGCATTGGCTGACCTGGTGGTGGCCTTCTACCCCTACCCGCTAATCCTCGTGGCCATCTTCTATGACGGCTGGGCCCTGGGGGAGGAGCACTGCAAGGCCAGCGCCTTTGTGATGGGCCTGAGCGTCATCGGCTCTGTCTTCAATATCACTGCCATCGCCATTAACCGCTACTGCTACATCTGCCACAGCATGGCCTACCACCGAATCTACCGGCGCTGGCACACCCCTCTGCACATCTGCCTCATCTGGCTCCTCACCGTGGTGGCCTTGCTGCCCAACTTCTTTGTGGGGTCCCTGGAGTACGACCCACGCATCTATTCCTGCACCTTCATCCAGACCGCCAGCACCCAGTACACGGCGGCAGTGGTGGTCATCCACTTCCTCCTCCCTATCGCTGTCGTGTCCTTCTGCTACCTGCGCATCTGGGTGCTGGTGCTTCAGGCCCGCAGGAAAGCCAAGCCAGAGAGCAGGCTGTGCCTGAAGCCCAGCGACTTGCGGAGCTTTCTAACCATGTTTGTGGTGTTTGTGATCTTTGCCATCTGCTGGGCTCCACTTAACTGCATCGGCCTCGCTGTGGCCATCAACCCCCAAGAAATGGCTCCCCAGATCCCTGAGGGGCTATTTGTCACTAGCTACTTACTGGCTTATTTCAACAGCTGCCTGAATGCCATTGTCTATGGGCTCTTGAACCAAAACTTCCGCAGGGAATACAAGAGGATCCTCTTGGCCCTTTGGAACCCACGGCACTGCATTCAAGATGCTTCCAAGGGCAGCCACGCGGAGGGGCTGCAGAGCCCAGCTCCACCCATCATTGGTGTGCAGCACCAGGCAGATGCTCTCTAG

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T48268-Ab Anti-MTR1B/ MTNR1B/ FGQTL2 monoclonal antibody
    Target Antigen GM-Tg-g-T48268-Ag MTNR1B VLP (virus-like particle)
    ORF Viral Vector pGMLP003857 Human MTNR1B Lentivirus plasmid
    ORF Viral Vector vGMLP003857 Human MTNR1B Lentivirus particle


    Target information

    Target ID GM-T48268
    Target Name MTNR1B
    Gene ID 4544, 244701, 695629, 192646, 101083701, 607818, 528665, 100059172
    Gene Symbol and Synonyms FGQTL2,MEL-1B-R,Mel1b,Mel1b-r,MT2,MTNR1B
    Uniprot Accession P49286
    Uniprot Entry Name MTR1B_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target
    Disease Not Available
    Gene Ensembl ENSG00000134640
    Target Classification GPCR

    This gene encodes one of two high affinity forms of a receptor for melatonin, the primary hormone secreted by the pineal gland. This gene product is an integral membrane protein that is a G-protein coupled, 7-transmembrane receptor. It is found primarily in the retina and brain although this detection requires RT-PCR. It is thought to participate in light-dependent functions in the retina and may be involved in the neurobiological effects of melatonin. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.