Human BTC ORF/cDNA clone-Lentivirus plasmid (BC011618)

Pre-made Human BTC/ Lentiviral expression plasmid for BTC lentivirus packaging, BTC lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

Target products collectionGo to BTC/ products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMLP003911 Human BTC Lentivirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMLP003911
Gene Name BTC
Accession Number BC011618
Gene ID 685
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 537 bp
Gene Alias
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGGACCGGGCCGCCCGGTGCAGCGGCGCCAGCTCCCTGCCACTGCTCCTGGCCCTTGCCCTGGGTCTAGTGATCCTTCACTGTGTGGTGGCAGATGGGAATTCCACCAGAAGTCCTGAAACTAATGGCCTCCTCTGTGGAGACCCTGAGGAAAACTGTGCAGCTACCACCACACAATCAAAGCGGAAAGGCCACTTCTCTAGGTGCCCCAAGCAATACAAGCATTACTGCATCAAAGGGAGATGCCGCTTCGTGGTGGCCGAGCAGACGCCCTCCTGTGTCTGTGATGAAGGCTACATTGGAGCAAGGTGTGAGAGAGTTGACTTGTTTTACCTAAGAGGAGACAGAGGACAGATTCTGGTGATTTGTATGATAGCAGTTATGGTAGTTTTTATTATTTTGGTCATCGGTGTCTGCACATGCTGTCACCCTCTTCGGAAACGTCGTAAAAGAAAGAAGAAAGAAGAAGAAATGGAAACTCTGGGTAAAGATATAACTCCTATCAATGAAGATATTGAAGAGACAAATATTGCTTAA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-MP0142-Ab Anti-BTC monoclonal antibody
    Target Antigen GM-Tg-g-MP0142-Ag BTC VLP (virus-like particle)
    Cytokine cks-Tg-g-GM-MP0142 betacellulin (BTC) protein & antibody
    ORF Viral Vector pGMLP003424 Human BTC Lentivirus plasmid
    ORF Viral Vector pGMLP003911 Human BTC Lentivirus plasmid
    ORF Viral Vector vGMLP003424 Human BTC Lentivirus particle
    ORF Viral Vector vGMLP003911 Human BTC Lentivirus particle


    Target information

    Target ID GM-MP0142
    Target Name BTC
    Gene ID 685, 12223, 702178, 64022, 101092850, 482682, 280737, 100056845
    Gene Symbol and Synonyms Bcn,BTC
    Uniprot Accession P35070
    Uniprot Entry Name BTC_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Cytokine Target
    Disease Not Available
    Gene Ensembl ENSG00000174808
    Target Classification Not Available

    This gene encodes a member of the epidermal growth factor (EGF) family of proteins. Alternative splicing results in multiple transcript variants, at least one of which encodes a preproprotein that is proteolytically processed to generate the secreted growth factor. A secreted form and a membrane-anchored form of this protein bind to multiple different EGF receptors. This protein promotes pancreatic cell proliferation and insulin secretion, as well as retinal vascular permeability. Mutations in this gene may be associated with type 2 diabetes in human patients. [provided by RefSeq, Nov 2015]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.