Human BTC ORF/cDNA clone-Lentivirus particle (NM_001729)
Pre-made Human BTC/ Lentiviral expression plasmid for BTC lentivirus packaging, BTC lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go
to BTC/ products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
---|---|---|---|
vGMLP003424 | Human BTC Lentivirus particle | Pilot Grade | 1.0E+8TU |
5.0E+8TU | |||
1.0E+9TU | |||
Research Grade | 1.0E+8TU | ||
5.0E+8TU | |||
1.0E+9TU | |||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMLP003424 |
Gene Name | BTC |
Accession Number | NM_001729 |
Gene ID | 685 |
Species | Human |
Product Type | Lentivirus particle (overexpression) |
Insert Length | 537 bp |
Gene Alias | |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGGACCGGGCCGCCCGGTGCAGCGGCGCCAGCTCCCTGCCACTGCTCCTGGCCCTTGCCCTGGGTCTAGTGATCCTTCACTGTGTGGTGGCAGATGGGAATTCCACCAGAAGTCCTGAAACTAATGGCCTCCTCTGTGGAGACCCTGAGGAAAACTGTGCAGCTACCACCACACAATCAAAGCGGAAAGGCCACTTCTCTAGGTGCCCCAAGCAATACAAGCATTACTGCATCAAAGGGAGATGCCGCTTCGTGGTGGCCGAGCAGACGCCCTCCTGTGTCTGTGATGAAGGCTACATTGGAGCAAGGTGTGAGAGAGTTGACTTGTTTTACCTAAGAGGAGACAGAGGACAGATTCTGGTGATTTGTTTGATAGCAGTTATGGTAGTTTTTATTATTTTGGTCATCGGTGTCTGCACATGCTGTCACCCTCTTCGGAAACGTCGTAAAAGAAAGAAGAAAGAAGAAGAAATGGAAACTCTGGGTAAAGATATAACTCCTATCAATGAAGATATTGAAGAGACAAATATTGCTTAA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-MP0142-Ab | Anti-BTC monoclonal antibody |
Target Antigen | GM-Tg-g-MP0142-Ag | BTC VLP (virus-like particle) |
Cytokine | cks-Tg-g-GM-MP0142 | betacellulin (BTC) protein & antibody |
ORF Viral Vector | pGMLP003424 | Human BTC Lentivirus plasmid |
ORF Viral Vector | pGMLP003911 | Human BTC Lentivirus plasmid |
ORF Viral Vector | vGMLP003424 | Human BTC Lentivirus particle |
ORF Viral Vector | vGMLP003911 | Human BTC Lentivirus particle |
Target information
Target ID | GM-MP0142 |
Target Name | BTC |
Gene ID | 685, 12223, 702178, 64022, 101092850, 482682, 280737, 100056845 |
Gene Symbol and Synonyms | Bcn,BTC |
Uniprot Accession | P35070 |
Uniprot Entry Name | BTC_HUMAN |
Protein Sub-location | Transmembrane Protein |
Category | Cytokine Target |
Disease | Not Available |
Gene Ensembl | ENSG00000174808 |
Target Classification | Not Available |
This gene encodes a member of the epidermal growth factor (EGF) family of proteins. Alternative splicing results in multiple transcript variants, at least one of which encodes a preproprotein that is proteolytically processed to generate the secreted growth factor. A secreted form and a membrane-anchored form of this protein bind to multiple different EGF receptors. This protein promotes pancreatic cell proliferation and insulin secretion, as well as retinal vascular permeability. Mutations in this gene may be associated with type 2 diabetes in human patients. [provided by RefSeq, Nov 2015]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.