Human HTRA2/MGCA8/OMI ORF/cDNA clone-Lentivirus plasmid (NM_013247)
Cat. No.: pGMLP003934
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days
Pre-made Human HTRA2/MGCA8/OMI Lentiviral expression plasmid for HTRA2 lentivirus packaging, HTRA2 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go to
HTRA2/MGCA8 products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product Description
Catalog ID | pGMLP003934 |
Gene Name | HTRA2 |
Accession Number | NM_013247 |
Gene ID | 27429 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 1377 bp |
Gene Alias | MGCA8,OMI,PARK13,PRSS25 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
ORF Nucleotide Sequence | ATGGCTGCGCCGAGGGCGGGGCGGGGTGCAGGCTGGAGCCTTCGGGCATGGCGGGCTTTGGGGGGCATTCGCTGGGGGAGGAGACCCCGTTTGACCCCTGACCTCCGGGCCCTGCTGACGTCAGGAACTTCTGACCCCCGGGCCCGAGTGACTTATGGGACCCCCAGTCTCTGGGCCCGGTTGTCTGTTGGGGTCACTGAACCCCGAGCATGCCTGACGTCTGGGACCCCGGGTCCCCGGGCACAACTGACTGCGGTGACCCCAGATACCAGGACCCGGGAGGCCTCAGAGAACTCTGGAACCCGTTCGCGCGCGTGGCTGGCGGTGGCGCTGGGCGCTGGGGGGGCAGTGCTGTTGTTGTTGTGGGGCGGGGGTCGGGGTCCTCCGGCCGTCCTCGCCGCCGTCCCTAGCCCGCCGCCCGCTTCTCCCCGGAGTCAGTACAACTTCATCGCAGATGTGGTGGAGAAGACAGCACCTGCCGTGGTCTATATCGAGATCCTGGACCGGCACCCTTTCTTGGGCCGCGAGGTCCCTATCTCGAACGGCTCAGGATTCGTGGTGGCTGCCGATGGGCTCATTGTCACCAACGCCCATGTGGTGGCTGATCGGCGCAGAGTCCGTGTGAGACTGCTAAGCGGCGACACGTATGAGGCCGTGGTCACAGCTGTGGATCCCGTGGCAGACATCGCAACGCTGAGGATTCAGACTAAGGAGCCTCTCCCCACGCTGCCTCTGGGACGCTCAGCTGATGTCCGGCAAGGGGAGTTTGTTGTTGCCATGGGAAGTCCCTTTGCACTGCAGAACACGATCACATCCGGCATTGTTAGCTCTGCTCAGCGTCCAGCCAGAGACCTGGGACTCCCCCAAACCAATGTGGAATACATTCAAACTGATGCAGCTATTGATTTTGGAAACTCTGGAGGTCCCCTGGTTAACCTGGATGGGGAGGTGATTGGAGTGAACACCATGAAGGTCACAGCTGGAATCTCCTTTGCCATCCCTTCTGATCGTCTTCGAGAGTTTCTGCATCGTGGGGAAAAGAAGAATTCCTCCTCCGGAATCAGTGGGTCCCAGCGGCGCTACATTGGGGTGATGATGCTGACCCTGAGTCCCAGCATCCTTGCTGAACTACAGCTTCGAGAACCAAGCTTTCCCGATGTTCAGCATGGTGTACTCATCCATAAAGTCATCCTGGGCTCCCCTGCACACCGGGCTGGTCTGCGGCCTGGTGATGTGATTTTGGCCATTGGGGAGCAGATGGTACAAAATGCTGAAGATGTTTATGAAGCTGTTCGAACCCAATCCCAGTTGGCAGTGCAGATCCGGCGGGGACGAGAAACACTGACCTTATATGTGACCCCTGAGGTCACAGAATGA |
ORF Protein Sequence | MAAPRAGRGAGWSLRAWRALGGIRWGRRPRLTPDLRALLTSGTSDPRARVTYGTPSLWARLSVGVTEPRACLTSGTPGPRAQLTAVTPDTRTREASENSGTRSRAWLAVALGAGGAVLLLLWGGGRGPPAVLAAVPSPPPASPRSQYNFIADVVEKTAPAVVYIEILDRHPFLGREVPISNGSGFVVAADGLIVTNAHVVADRRRVRVRLLSGDTYEAVVTAVDPVADIATLRIQTKEPLPTLPLGRSADVRQGEFVVAMGSPFALQNTITSGIVSSAQRPARDLGLPQTNVEYIQTDAAIDFGNSGGPLVNLDGEVIGVNTMKVTAGISFAIPSDRLREFLHRGEKKNSSSGISGSQRRYIGVMMLTLSPSILAELQLREPSFPDVQHGVLIHKVILGSPAHRAGLRPGDVILAIGEQMVQNAEDVYEAVRTQSQLAVQIRRGRETLTLYVTPEVTE |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-IP0992-Ab | Anti-HTRA2 monoclonal antibody |
Target Antigen | GM-Tg-g-IP0992-Ag | HTRA2 protein |
ORF Viral Vector | pGMLP003934 | Human HTRA2 Lentivirus plasmid |
ORF Viral Vector | vGMLP003934 | Human HTRA2 Lentivirus particle |
Target information
Target ID | GM-IP0992 |
Target Name | HTRA2 |
Gene ID | 27429, 64704, 709938, 297376, 768259, 475782, 523039, 100053688 |
Gene Symbol and Synonyms | HTRA2,MGCA8,mnd2,OMI,PARK13,PRSS25 |
Uniprot Accession | O43464 |
Uniprot Entry Name | HTRA2_HUMAN |
Protein Sub-location | Introcelluar Protein |
Category | Not Available |
Disease | Not Available |
Gene Ensembl | ENSG00000115317 |
Target Classification | Not Available |
This gene encodes a serine protease. The protein has been localized in the endoplasmic reticulum and interacts with an alternatively spliced form of mitogen-activated protein kinase 14. The protein has also been localized to the mitochondria with release to the cytosol following apoptotic stimulus. The protein is thought to induce apoptosis by binding the apoptosis inhibitory protein baculoviral IAP repeat-containing 4. Nuclear localization of this protein has also been observed. Alternate splicing of this gene results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Mar 2016]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.