Human PIP4K2A/PI5P4KA/ PIP5K2A ORF/cDNA clone-Lentivirus plasmid (NM_005028)

Pre-made Human PIP4K2A/PI5P4KA/ PIP5K2A Lentiviral expression plasmid for PIP4K2A lentivirus packaging, PIP4K2A lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

Target products collectionGo to PIP4K2A/PI5P4KA products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMLP003965 Human PIP4K2A Lentivirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMLP003965
Gene Name PIP4K2A
Accession Number NM_005028
Gene ID 5305
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 1221 bp
Gene Alias PI5P4KA, PIP5K2A, PIP5KII-alpha, PIP5KIIA, PIPK
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGGCGACCCCCGGCAACCTAGGGTCCTCTGTCCTGGCGAGCAAGACCAAGACCAAGAAGAAGCACTTCGTAGCGCAGAAAGTGAAGCTGTTTCGGGCCAGCGACCCGCTGCTCAGCGTCCTCATGTGGGGGGTAAACCACTCGATCAATGAACTGAGCCATGTTCAAATCCCTGTTATGTTGATGCCAGATGACTTCAAAGCCTATTCAAAAATAAAGGTGGACAATCACCTTTTTAACAAAGAAAACATGCCGAGCCATTTCAAGTTTAAGGAATACTGCCCGATGGTCTTCCGTAACCTGCGGGAGAGGTTTGGAATTGATGATCAAGATTTCCAGAATTCCCTGACCAGGAGCGCACCCCTCCCCAACGACTCCCAGGCCCGCAGTGGAGCTCGTTTTCACACTTCCTACGACAAAAGATACATCATCAAGACTATTACCAGTGAAGACGTGGCCGAAATGCACAACATCCTGAAGAAATACCACCAGTACATAGTGGAATGTCATGGGATCACCCTTCTTCCCCAGTTCTTGGGCATGTACCGGCTTAATGTTGATGGAGTTGAAATATATGTGATAGTTACAAGAAATGTATTCAGCCACCGTTTGTCTGTGTATAGGAAATACGACTTAAAGGGCTCTACAGTGGCTAGAGAAGCTAGTGACAAAGAAAAGGCCAAAGAACTGCCAACTCTGAAAGATAATGATTTCATTAATGAGGGCCAAAAGATTTATATTGATGACAACAACAAGAAGGTCTTCCTGGAAAAACTAAAAAAGGATGTTGAGTTTCTGGCCCAGCTGAAGCTCATGGACTACAGTCTGCTGGTGGGAATTCATGATGTGGAGAGAGCCGAACAGGAGGAAGTGGAGTGTGAGGAGAACGATGGGGAGGAGGAGGGCGAGAGCGATGGCACCCACCCGGTGGGAACCCCCCCAGATAGCCCCGGGAATACACTGAACAGCTCACCACCCCTGGCTCCCGGGGAGTTCGATCCGAACATCGACGTCTATGGAATTAAGTGCCATGAAAACTCGCCTAGGAAGGAGGTGTACTTCATGGCAATTATTGACATCCTTACTCATTATGATGCAAAAAAGAAAGCTGCCCATGCTGCAAAAACTGTTAAACATGGCGCTGGCGCGGAGATCTCCACCGTGAACCCAGAACAGTATTCAAAGCGCTTTTTGGACTTTATTGGCCACATCTTGACGTAA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-MP2243-Ab Anti-PI42A/ PIP4K2A/ PI5P4KA monoclonal antibody
    Target Antigen GM-Tg-g-MP2243-Ag PIP4K2A VLP (virus-like particle)
    ORF Viral Vector pGMLV000227 Human PIP4K2A Lentivirus plasmid
    ORF Viral Vector pGMLP003965 Human PIP4K2A Lentivirus plasmid
    ORF Viral Vector vGMLV000227 Human PIP4K2A Lentivirus particle
    ORF Viral Vector vGMLP003965 Human PIP4K2A Lentivirus particle


    Target information

    Target ID GM-MP2243
    Target Name PIP4K2A
    Gene ID 5305, 18718, 710724, 116723, 101096576, 608414, 533289, 100066733
    Gene Symbol and Synonyms PI5P4KA,PIP4K2A,PIP5K2A,PIP5KII-alpha,PIP5KIIA,PIPK
    Uniprot Accession P48426
    Uniprot Entry Name PI42A_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000150867
    Target Classification Not Available

    Phosphatidylinositol-5,4-bisphosphate, the precursor to second messengers of the phosphoinositide signal transduction pathways, is thought to be involved in the regulation of secretion, cell proliferation, differentiation, and motility. The protein encoded by this gene is one of a family of enzymes capable of catalyzing the phosphorylation of phosphatidylinositol-5-phosphate on the fourth hydroxyl of the myo-inositol ring to form phosphatidylinositol-5,4-bisphosphate. The amino acid sequence of this enzyme does not show homology to other kinases, but the recombinant protein does exhibit kinase activity. This gene is a member of the phosphatidylinositol-5-phosphate 4-kinase family. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.