Human PIP4K2A/PI5P4KA/PIP5K2A ORF/cDNA clone-Lentivirus plasmid (NM_005028.4)
Cat. No.: pGMLV000227
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days
Pre-made Human PIP4K2A/PI5P4KA/PIP5K2A Lentiviral expression plasmid for PIP4K2A lentivirus packaging, PIP4K2A lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go to
PIP4K2A/PI5P4KA products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product Description
Catalog ID | pGMLV000227 |
Gene Name | PIP4K2A |
Accession Number | NM_005028.4 |
Gene ID | 5305 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 1221 bp |
Gene Alias | PI5P4KA,PIP5K2A,PIP5KII-alpha,PIP5KIIA,PIPK |
Fluorescent Reporter | Null |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | Null |
Promoter | CMV |
Resistance | Amplicin |
ORF Nucleotide Sequence | ATGGCGACCCCCGGCAACCTAGGGTCCTCTGTCCTGGCGAGCAAGACCAAGACCAAGAAGAAGCACTTCGTAGCGCAGAAAGTGAAGCTGTTTCGGGCCAGCGACCCGCTGCTCAGCGTCCTCATGTGGGGGGTAAACCACTCGATCAATGAACTGAGCCATGTTCAAATCCCTGTTATGTTGATGCCAGATGACTTCAAAGCCTATTCAAAAATAAAGGTGGACAATCACCTTTTTAACAAAGAAAACATGCCGAGCCATTTCAAGTTTAAGGAATACTGCCCGATGGTCTTCCGTAACCTGCGGGAGAGGTTTGGAATTGATGATCAAGATTTCCAGAATTCCCTGACCAGGAGCGCACCCCTCCCCAACGACTCCCAGGCCCGCAGTGGAGCTCGTTTTCACACTTCCTACGACAAAAGATACATCATCAAGACTATTACCAGTGAAGACGTGGCCGAAATGCACAACATCCTGAAGAAATACCACCAGTACATAGTGGAATGTCATGGGATCACCCTTCTTCCCCAGTTCTTGGGCATGTACCGGCTTAATGTTGATGGAGTTGAAATATATGTGATAGTTACAAGAAATGTATTCAGCCACCGTTTGTCTGTGTATAGGAAATACGACTTAAAGGGCTCTACAGTGGCTAGAGAAGCTAGTGACAAAGAAAAGGCCAAAGAACTGCCAACTCTGAAAGATAATGATTTCATTAATGAGGGCCAAAAGATTTATATTGATGACAACAACAAGAAGGTCTTCCTGGAAAAACTAAAAAAGGATGTTGAGTTTCTGGCCCAGCTGAAGCTCATGGACTACAGTCTGCTGGTGGGAATTCATGATGTGGAGAGAGCCGAACAGGAGGAAGTGGAGTGTGAGGAGAACGATGGGGAGGAGGAGGGCGAGAGCGATGGCACCCACCCGGTGGGAACCCCCCCAGATAGCCCCGGGAATACACTGAACAGCTCACCACCCCTGGCTCCCGGGGAGTTCGATCCGAACATCGACGTCTATGGAATTAAGTGCCATGAAAACTCGCCTAGGAAGGAGGTGTACTTCATGGCAATTATTGACATCCTTACTCATTATGATGCAAAAAAGAAAGCTGCCCATGCTGCAAAAACTGTTAAACATGGCGCTGGCGCGGAGATCTCCACCGTGAACCCAGAACAGTATTCAAAGCGCTTTTTGGACTTTATTGGCCACATCTTGACGTAA |
ORF Protein Sequence | MATPGNLGSSVLASKTKTKKKHFVAQKVKLFRASDPLLSVLMWGVNHSINELSHVQIPVMLMPDDFKAYSKIKVDNHLFNKENMPSHFKFKEYCPMVFRNLRERFGIDDQDFQNSLTRSAPLPNDSQARSGARFHTSYDKRYIIKTITSEDVAEMHNILKKYHQYIVECHGITLLPQFLGMYRLNVDGVEIYVIVTRNVFSHRLSVYRKYDLKGSTVAREASDKEKAKELPTLKDNDFINEGQKIYIDDNNKKVFLEKLKKDVEFLAQLKLMDYSLLVGIHDVERAEQEEVECEENDGEEEGESDGTHPVGTPPDSPGNTLNSSPPLAPGEFDPNIDVYGIKCHENSPRKEVYFMAIIDILTHYDAKKKAAHAAKTVKHGAGAEISTVNPEQYSKRFLDFIGHILT |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-MP2243-Ab | Anti-PI42A/ PIP4K2A/ PI5P4KA monoclonal antibody |
Target Antigen | GM-Tg-g-MP2243-Ag | PIP4K2A VLP (virus-like particle) |
ORF Viral Vector | pGMLP003965 | Human PIP4K2A Lentivirus plasmid |
ORF Viral Vector | pGMLV000227 | Human PIP4K2A Lentivirus plasmid |
ORF Viral Vector | vGMLP003965 | Human PIP4K2A Lentivirus particle |
ORF Viral Vector | vGMLV000227 | Human PIP4K2A Lentivirus particle |
Target information
Target ID | GM-MP2243 |
Target Name | PIP4K2A |
Gene ID | 5305, 18718, 710724, 116723, 101096576, 608414, 533289, 100066733 |
Gene Symbol and Synonyms | PI5P4KA,PIP4K2A,PIP5K2A,PIP5KII-alpha,PIP5KIIA,PIPK |
Uniprot Accession | P48426 |
Uniprot Entry Name | PI42A_HUMAN |
Protein Sub-location | Transmembrane Protein |
Category | Not Available |
Disease | Not Available |
Gene Ensembl | ENSG00000150867 |
Target Classification | Not Available |
Phosphatidylinositol-5,4-bisphosphate, the precursor to second messengers of the phosphoinositide signal transduction pathways, is thought to be involved in the regulation of secretion, cell proliferation, differentiation, and motility. The protein encoded by this gene is one of a family of enzymes capable of catalyzing the phosphorylation of phosphatidylinositol-5-phosphate on the fourth hydroxyl of the myo-inositol ring to form phosphatidylinositol-5,4-bisphosphate. The amino acid sequence of this enzyme does not show homology to other kinases, but the recombinant protein does exhibit kinase activity. This gene is a member of the phosphatidylinositol-5-phosphate 4-kinase family. [provided by RefSeq, Jul 2008]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.