Human SLC31A1/COPT1/CTR1 ORF/cDNA clone-Lentivirus plasmid (NM_001859.3)

Cat. No.: pGMLP003981
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human SLC31A1/COPT1/CTR1 Lentiviral expression plasmid for SLC31A1 lentivirus packaging, SLC31A1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.


Target products collection

Go to SLC31A1/COPT1 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $443.25
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP003981
Gene Name SLC31A1
Accession Number NM_001859.3
Gene ID 1317
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 573 bp
Gene Alias COPT1,CTR1
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGATCATTCCCACCATATGGGGATGAGCTATATGGACTCCAACAGTACCATGCAACCTTCTCACCATCACCCAACCACTTCAGCCTCACACTCCCATGGTGGAGGAGACAGCAGCATGATGATGATGCCTATGACCTTCTACTTTGGCTTTAAGAATGTGGAACTACTGTTTTCCGGTTTGGTGATCAATACAGCTGGAGAAATGGCTGGAGCTTTTGTGGCAGTGTTTTTACTAGCAATGTTCTATGAAGGACTCAAGATAGCCCGAGAGAGCCTGCTGCGTAAGTCACAAGTCAGCATTCGCTACAATTCCATGCCTGTCCCAGGACCAAATGGAACCATCCTTATGGAGACACACAAAACTGTTGGGCAACAGATGCTGAGCTTTCCTCACCTCCTGCAAACAGTGCTGCACATCATCCAGGTGGTCATAAGCTACTTCCTCATGCTCATCTTCATGACCTACAACGGGTACCTCTGCATTGCAGTAGCAGCAGGGGCCGGTACAGGATACTTCCTCTTCAGCTGGAAGAAGGCAGTGGTAGTGGATATCACAGAGCATTGCCATTGA
ORF Protein Sequence MDHSHHMGMSYMDSNSTMQPSHHHPTTSASHSHGGGDSSMMMMPMTFYFGFKNVELLFSGLVINTAGEMAGAFVAVFLLAMFYEGLKIARESLLRKSQVSIRYNSMPVPGPNGTILMETHKTVGQQMLSFPHLLQTVLHIIQVVISYFLMLIFMTYNGYLCIAVAAGAGTGYFLFSWKKAVVVDITEHCH

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-MP1603-Ab Anti-COPT1/ SLC31A1/ CTR1 monoclonal antibody
    Target Antigen GM-Tg-g-MP1603-Ag SLC31A1 VLP (virus-like particle)
    ORF Viral Vector pGMLP003981 Human SLC31A1 Lentivirus plasmid
    ORF Viral Vector vGMLP003981 Human SLC31A1 Lentivirus particle


    Target information

    Target ID GM-MP1603
    Target Name SLC31A1
    Gene ID 1317, 20529, 706058, 171135, 101081582, 481678, 518976, 100050369
    Gene Symbol and Synonyms 4930445G01Rik,COPT1,CTR1,LRRGT00200,NSCT,SLC31A1
    Uniprot Accession O15431
    Uniprot Entry Name COPT1_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Not Available
    Disease Pregnant state
    Gene Ensembl ENSG00000136868
    Target Classification Not Available

    The protein encoded by this gene is a high-affinity copper transporter found in the cell membrane. The encoded protein functions as a homotrimer to effect the uptake of dietary copper. [provided by RefSeq, Aug 2011]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.