Human GCSH/GCE/ NKH ORF/cDNA clone-Lentivirus plasmid (BC000790)

Pre-made Human GCSH/GCE/ NKH Lentiviral expression plasmid for GCSH lentivirus packaging, GCSH lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

Target products collectionGo to GCSH/GCE products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMLP004014 Human GCSH Lentivirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMLP004014
Gene Name GCSH
Accession Number BC000790
Gene ID 2653
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 522 bp
Gene Alias GCE, NKH
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGGCGCTGCGAGTGGTGCGGAGCGTGCGGGCCCTGCTCTGCACCCTGCGCGCGGTCCCGTTACCCGCCGCGCCCTGCCCGCCGAGGCCCTGGCAGCTGGGGGTGGGCGCCGTCCGTACGCTGCGCACTGGACCCGCTCTGCTCTCGGTGCGTAAATTCACAGAGAAACACGAATGGGTAACAACAGAAAATGGCATTGGAACAGTGGGAATCAGCAATTTTGCACAGGAAGCGTTGGGAGATGTTGTTTATTGTAGTCTCCCTGAAGTTGGGACAAAATTGAACAAACAAGATGAGTTTGGTGCTTTGGAAAGTGTGAAAGCTGCTAGTGAACTCTATTCTCCTTTATCAGGAGAAGTAACTGAAATTAATGAAGCTCTTGCAGAAAATCCAGGACTTGTAAACAAATCTTGTTATGAAGATGGTTGGCTGATCAAGATGACACTGAGTAACCCTTCAGAACTAGATGAACTTATGAGTGAAGAAGCATATGAGAAATACATAAAATCTATTGAGGAGTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE1517-Ab Anti-GCSH/ GCE/ NKH functional antibody
    Target Antigen GM-Tg-g-SE1517-Ag GCSH protein
    ORF Viral Vector pGMLP002763 Human GCSH Lentivirus plasmid
    ORF Viral Vector pGMLP004014 Human GCSH Lentivirus plasmid
    ORF Viral Vector vGMLP002763 Human GCSH Lentivirus particle
    ORF Viral Vector vGMLP004014 Human GCSH Lentivirus particle


    Target information

    Target ID GM-SE1517
    Target Name GCSH
    Gene ID 2653, 68133, 717440, 171133, 101084333, 479633, 317723, 100629755
    Gene Symbol and Synonyms 1100001L02Rik,5730591C18Rik,GCE,GCSH,NKH
    Uniprot Accession P23434
    Uniprot Entry Name GCSH_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000140905
    Target Classification Not Available

    Degradation of glycine is brought about by the glycine cleavage system, which is composed of four mitochondrial protein components: P protein (a pyridoxal phosphate-dependent glycine decarboxylase), H protein (a lipoic acid-containing protein), T protein (a tetrahydrofolate-requiring enzyme), and L protein (a lipoamide dehydrogenase). The protein encoded by this gene is the H protein, which transfers the methylamine group of glycine from the P protein to the T protein. Defects in this gene are a cause of nonketotic hyperglycinemia (NKH). Two transcript variants, one protein-coding and the other probably not protein-coding,have been found for this gene. Also, several transcribed and non-transcribed pseudogenes of this gene exist throughout the genome.[provided by RefSeq, Jan 2010]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.