Human GCSH/GCE/ NKH ORF/cDNA clone-Lentivirus particle (NM_004483)
Pre-made Human GCSH/GCE/ NKH Lentiviral expression plasmid for GCSH lentivirus packaging, GCSH lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go
to GCSH/GCE products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
---|---|---|---|
vGMLP002763 | Human GCSH Lentivirus particle | Pilot Grade | 1.0E+8TU |
5.0E+8TU | |||
1.0E+9TU | |||
Research Grade | 1.0E+8TU | ||
5.0E+8TU | |||
1.0E+9TU | |||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMLP002763 |
Gene Name | GCSH |
Accession Number | NM_004483 |
Gene ID | 2653 |
Species | Human |
Product Type | Lentivirus particle (overexpression) |
Insert Length | 522 bp |
Gene Alias | GCE, NKH |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGGCGCTGCGAGTGGTGCGGAGCGTGCGGGCCCTGCTCTGCACCCTGCGCGCGGTCCCGTCACCCGCCGCGCCCTGCCCGCCGAGGCCCTGGCAGCTGGGGGTGGGCGCCGTCCGTACGCTGCGCACTGGACCCGCTCTGCTCTCGGTGCGTAAATTCACAGAGAAACACGAATGGGTAACAACAGAAAATGGCATTGGAACAGTGGGAATCAGCAATTTTGCACAGGAAGCGTTGGGAGATGTTGTTTATTGTAGTCTCCCTGAAGTTGGGACAAAATTGAACAAACAAGATGAGTTTGGTGCTTTGGAAAGTGTGAAAGCTGCTAGTGAACTCTATTCTCCTTTATCAGGAGAAGTAACTGAAATTAATGAAGCTCTTGCAGAAAATCCAGGACTTGTAAACAAATCTTGTTATGAAGATGGTTGGCTGATCAAGATGACACTGAGTAACCCTTCAGAACTAGATGAACTTATGAGTGAAGAAGCATATGAGAAATACATAAAATCTATTGAGGAGTGA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-SE1517-Ab | Anti-GCSH/ GCE/ NKH functional antibody |
Target Antigen | GM-Tg-g-SE1517-Ag | GCSH protein |
ORF Viral Vector | pGMLP002763 | Human GCSH Lentivirus plasmid |
ORF Viral Vector | pGMLP004014 | Human GCSH Lentivirus plasmid |
ORF Viral Vector | vGMLP002763 | Human GCSH Lentivirus particle |
ORF Viral Vector | vGMLP004014 | Human GCSH Lentivirus particle |
Target information
Target ID | GM-SE1517 |
Target Name | GCSH |
Gene ID | 2653, 68133, 717440, 171133, 101084333, 479633, 317723, 100629755 |
Gene Symbol and Synonyms | 1100001L02Rik,5730591C18Rik,GCE,GCSH,NKH |
Uniprot Accession | P23434 |
Uniprot Entry Name | GCSH_HUMAN |
Protein Sub-location | Secreted Protein/Potential Cytokines |
Category | Not Available |
Disease | Not Available |
Gene Ensembl | ENSG00000140905 |
Target Classification | Not Available |
Degradation of glycine is brought about by the glycine cleavage system, which is composed of four mitochondrial protein components: P protein (a pyridoxal phosphate-dependent glycine decarboxylase), H protein (a lipoic acid-containing protein), T protein (a tetrahydrofolate-requiring enzyme), and L protein (a lipoamide dehydrogenase). The protein encoded by this gene is the H protein, which transfers the methylamine group of glycine from the P protein to the T protein. Defects in this gene are a cause of nonketotic hyperglycinemia (NKH). Two transcript variants, one protein-coding and the other probably not protein-coding,have been found for this gene. Also, several transcribed and non-transcribed pseudogenes of this gene exist throughout the genome.[provided by RefSeq, Jan 2010]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.