Human VDAC1/PORIN/VDAC-1 ORF/cDNA clone-Lentivirus plasmid (NM_003374.2)

Cat. No.: pGMLP004105
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human VDAC1/PORIN/VDAC-1 Lentiviral expression plasmid for VDAC1 lentivirus packaging, VDAC1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.


Target products collection

Go to VDAC1/PORIN products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $513
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP004105
Gene Name VDAC1
Accession Number NM_003374.2
Gene ID 7416
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 852 bp
Gene Alias PORIN,VDAC-1
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGCTGTGCCACCCACGTATGCCGATCTTGGCAAATCTGCCAGGGATGTCTTCACCAAGGGCTATGGATTTGGCTTAATAAAGCTTGATTTGAAAACAAAATCTGAGAATGGATTGGAATTTACAAGCTCAGGCTCAGCCAACACTGAGACCACCAAAGTGACGGGCAGTCTGGAAACCAAGTACAGATGGACTGAGTACGGCCTGACGTTTACAGAGAAATGGAATACCGACAATACACTAGGCACCGAGATTACTGTGGAAGATCAGCTTGCACGTGGACTGAAGCTGACCTTCGATTCATCCTTCTCACCTAACACTGGGAAAAAAAATGCTAAAATCAAGACAGGGTACAAGCGGGAGCACATTAACCTGGGCTGCGACATGGATTTCGACATTGCTGGGCCTTCCATCCGGGGTGCTCTGGTGCTAGGTTACGAGGGCTGGCTGGCCGGCTACCAGATGAATTTTGAGACTGCAAAATCCCGAGTGACCCAGAGCAACTTTGCAGTTGGCTACAAGACTGATGAATTCCAGCTTCACACTAATGTGAATGACGGGACAGAGTTTGGCGGCTCCATTTACCAGAAAGTGAACAAGAAGTTGGAGACCGCTGTCAATCTTGCCTGGACAGCAGGAAACAGTAACACGCGCTTCGGAATAGCAGCCAAGTATCAGATTGACCCTGACGCCTGCTTCTCGGCTAAAGTGAACAACTCCAGCCTGATAGGTTTAGGATACACTCAGACTCTAAAGCCAGGTATTAAACTGACACTGTCAGCTCTTCTGGATGGCAAGAACGTCAATGCTGGTGGCCACAAGCTTGGTCTAGGACTGGAATTTCAAGCATAA
ORF Protein Sequence MAVPPTYADLGKSARDVFTKGYGFGLIKLDLKTKSENGLEFTSSGSANTETTKVTGSLETKYRWTEYGLTFTEKWNTDNTLGTEITVEDQLARGLKLTFDSSFSPNTGKKNAKIKTGYKREHINLGCDMDFDIAGPSIRGALVLGYEGWLAGYQMNFETAKSRVTQSNFAVGYKTDEFQLHTNVNDGTEFGGSIYQKVNKKLETAVNLAWTAGNSNTRFGIAAKYQIDPDACFSAKVNNSSLIGLGYTQTLKPGIKLTLSALLDGKNVNAGGHKLGLGLEFQA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T99397-Ab Anti-VDAC1/ PORIN/ VDAC-1 monoclonal antibody
    Target Antigen GM-Tg-g-T99397-Ag VDAC1 VLP (virus-like particle)
    ORF Viral Vector pGMLP002015 Human VDAC1 Lentivirus plasmid
    ORF Viral Vector pGMLP004105 Human VDAC1 Lentivirus plasmid
    ORF Viral Vector pGMAP000083 Human VDAC1 Adenovirus plasmid
    ORF Viral Vector pGMLPm004021 Human VDAC1 Lentivirus plasmid
    ORF Viral Vector pGMLP-SPh-112 Human VDAC1 Lentivirus plasmid
    ORF Viral Vector pGMAP-SPh-252 Human VDAC1 Adenovirus plasmid
    ORF Viral Vector pGMPC000390 Human VDAC1 Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector vGMLP002015 Human VDAC1 Lentivirus particle
    ORF Viral Vector vGMLP004105 Human VDAC1 Lentivirus particle
    ORF Viral Vector vGMAP000083 Human VDAC1 Adenovirus particle
    ORF Viral Vector vGMLPm004021 Human VDAC1 Lentivirus particle
    ORF Viral Vector vGMLP-SPh-112 Human VDAC1 Lentivirus particle
    ORF Viral Vector vGMAP-SPh-252 Human VDAC1 Adenovirus particle


    Target information

    Target ID GM-T99397
    Target Name VDAC1
    Gene ID 7416, 22333, 710045, 83529, 101098515, 474681, 282119, 100062974
    Gene Symbol and Synonyms mVDAC1,mVDAC5,PORIN,VDAC-1,VDAC1,Vdac5
    Uniprot Accession P21796
    Uniprot Entry Name VDAC1_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target
    Disease Not Available
    Gene Ensembl ENSG00000213585
    Target Classification Not Available

    This gene encodes a voltage-dependent anion channel protein that is a major component of the outer mitochondrial membrane. The encoded protein facilitates the exchange of metabolites and ions across the outer mitochondrial membrane and may regulate mitochondrial functions. This protein also forms channels in the plasma membrane and may be involved in transmembrane electron transport. Alternate splicing results in multiple transcript variants. Multiple pseudogenes of this gene are found on chromosomes 1, 2 3, 6, 9, 12, X and Y.[provided by RefSeq, Sep 2010]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.