Human VDAC1/PORIN/VDAC-1 ORF/cDNA clone-Adenovirus particle (NM_003374.2)
Cat. No.: vGMAP-SPh-252
Pre-made Human VDAC1/PORIN/VDAC-1 Adenovirus for VDAC1 overexpression in-vitro and in-vivo. The VDAC1 adenoviral vector excels as a vehicle for transient gene transfection in both stable cell lines and primary cells, including DC cells, macrophages, cardiomyocytes, hepatocytes, and neurons. The purified VDAC1-encoding adenovirus also stands out as a quintessential tool for in vivo studies and vaccine research initiatives.
At GM Vector Core (GMVC), we provide bespoke adenovirus development and manufacture various grades of adenoviruses utilizing cutting-edge techniques. Dive deeper into our offerings.
Go to
VDAC1/PORIN products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
| Catalog No. | Product Name | Adenovirus Grade | Adenovirus quantity |
| vGMAP-SPh-252 | Human VDAC1 Adenovirus particle | Research Grade-In vitro | 1E+10PFU (1E+10pfu/ml×1ml) |
| 5E+10PFU (1E+10pfu/ml×5ml) | |||
| 1E+11PFU (1E+10pfu/ml×10ml) | |||
| Research Grade-In vivo | 1E+11PFU (1E+11pfu/ml×1ml) | ||
| GMP-like Grade | inquiry | ||
| GMP Grade | inquiry |
Product Description
| Catalog ID | vGMAP-SPh-252 |
| Gene Name | VDAC1 |
| Accession Number | NM_003374.2 |
| Gene ID | 7416 |
| Species | Human |
| Product Type | Adenovirus particle (overexpression) |
| Insert Length | 852 bp |
| Gene Alias | PORIN,VDAC-1 |
| Fluorescent Reporter | EGFP |
| Mammalian Cell Selection | Null |
| Fusion Tag | 3xflag (C-Terminal) |
| Promoter | EF1 |
| Resistance | Amplicin |
| ORF Nucleotide Sequence | ATGGCTGTGCCACCCACGTATGCCGATCTTGGCAAATCTGCCAGGGATGTCTTCACCAAGGGCTATGGATTTGGCTTAATAAAGCTTGATTTGAAAACAAAATCTGAGAATGGATTGGAATTTACAAGCTCAGGCTCAGCCAACACTGAGACCACCAAAGTGACGGGCAGTCTGGAAACCAAGTACAGATGGACTGAGTACGGCCTGACGTTTACAGAGAAATGGAATACCGACAATACACTAGGCACCGAGATTACTGTGGAAGATCAGCTTGCACGTGGACTGAAGCTGACCTTCGATTCATCCTTCTCACCTAACACTGGGAAAAAAAATGCTAAAATCAAGACAGGGTACAAGCGGGAGCACATTAACCTGGGCTGCGACATGGATTTCGACATTGCTGGGCCTTCCATCCGGGGTGCTCTGGTGCTAGGTTACGAGGGCTGGCTGGCCGGCTACCAGATGAATTTTGAGACTGCAAAATCCCGAGTGACCCAGAGCAACTTTGCAGTTGGCTACAAGACTGATGAATTCCAGCTTCACACTAATGTGAATGACGGGACAGAGTTTGGCGGCTCCATTTACCAGAAAGTGAACAAGAAGTTGGAGACCGCTGTCAATCTTGCCTGGACAGCAGGAAACAGTAACACGCGCTTCGGAATAGCAGCCAAGTATCAGATTGACCCTGACGCCTGCTTCTCGGCTAAAGTGAACAACTCCAGCCTGATAGGTTTAGGATACACTCAGACTCTAAAGCCAGGTATTAAACTGACACTGTCAGCTCTTCTGGATGGCAAGAACGTCAATGCTGGTGGCCACAAGCTTGGTCTAGGACTGGAATTTCAAGCATAA |
| ORF Protein Sequence | MAVPPTYADLGKSARDVFTKGYGFGLIKLDLKTKSENGLEFTSSGSANTETTKVTGSLETKYRWTEYGLTFTEKWNTDNTLGTEITVEDQLARGLKLTFDSSFSPNTGKKNAKIKTGYKREHINLGCDMDFDIAGPSIRGALVLGYEGWLAGYQMNFETAKSRVTQSNFAVGYKTDEFQLHTNVNDGTEFGGSIYQKVNKKLETAVNLAWTAGNSNTRFGIAAKYQIDPDACFSAKVNNSSLIGLGYTQTLKPGIKLTLSALLDGKNVNAGGHKLGLGLEFQA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
| Category | Cat No. | Products Name |
|---|---|---|
| Target Antibody | GM-Tg-g-T99397-Ab | Anti-VDAC1/ PORIN/ VDAC-1 monoclonal antibody |
| Target Antigen | GM-Tg-g-T99397-Ag | VDAC1 VLP (virus-like particle) |
| ORF Viral Vector | pGMLP002015 | Human VDAC1 Lentivirus plasmid |
| ORF Viral Vector | pGMLP004105 | Human VDAC1 Lentivirus plasmid |
| ORF Viral Vector | pGMAP000083 | Human VDAC1 Adenovirus plasmid |
| ORF Viral Vector | pGMLPm004021 | Human VDAC1 Lentivirus plasmid |
| ORF Viral Vector | pGMLP-SPh-112 | Human VDAC1 Lentivirus plasmid |
| ORF Viral Vector | pGMAP-SPh-252 | Human VDAC1 Adenovirus plasmid |
| ORF Viral Vector | pGMPC000390 | Human VDAC1 Mammalian (Non-Viral Vector) plasmid |
| ORF Viral Vector | vGMLP002015 | Human VDAC1 Lentivirus particle |
| ORF Viral Vector | vGMLP004105 | Human VDAC1 Lentivirus particle |
| ORF Viral Vector | vGMAP000083 | Human VDAC1 Adenovirus particle |
| ORF Viral Vector | vGMLPm004021 | Human VDAC1 Lentivirus particle |
| ORF Viral Vector | vGMLP-SPh-112 | Human VDAC1 Lentivirus particle |
| ORF Viral Vector | vGMAP-SPh-252 | Human VDAC1 Adenovirus particle |
Target information
| Target ID | GM-T99397 |
| Target Name | VDAC1 |
| Gene ID | 7416, 22333, 710045, 83529, 101098515, 474681, 282119, 100062974 |
| Gene Symbol and Synonyms | mVDAC1,mVDAC5,PORIN,VDAC-1,VDAC1,Vdac5 |
| Uniprot Accession | P21796 |
| Uniprot Entry Name | VDAC1_HUMAN |
| Protein Sub-location | Transmembrane Protein |
| Category | Therapeutics Target |
| Disease | Not Available |
| Gene Ensembl | ENSG00000213585 |
| Target Classification | Not Available |
This gene encodes a voltage-dependent anion channel protein that is a major component of the outer mitochondrial membrane. The encoded protein facilitates the exchange of metabolites and ions across the outer mitochondrial membrane and may regulate mitochondrial functions. This protein also forms channels in the plasma membrane and may be involved in transmembrane electron transport. Alternate splicing results in multiple transcript variants. Multiple pseudogenes of this gene are found on chromosomes 1, 2 3, 6, 9, 12, X and Y.[provided by RefSeq, Sep 2010]
About GMVC

GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.


