Human CD68/GP110/LAMP4 ORF/cDNA clone-Lentivirus plasmid (NM_001251)

Cat. No.: pGMLP004227
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human CD68/GP110/LAMP4 Lentiviral expression plasmid for CD68 lentivirus packaging, CD68 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.


Target products collection

Go to CD68/GP110 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $598.2
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP004227
Gene Name CD68
Accession Number NM_001251
Gene ID 968
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 1065 bp
Gene Alias GP110,LAMP4,SCARD1
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGAGGCTGGCTGTGCTTTTCTCGGGGGCCCTGCTGGGGCTACTGGCAGCCCAGGGGACAGGGAATGACTGTCCTCACAAAAAATCAGCTACTTTGCTGCCATCCTTCACGGTGACACCCACGGTTACAGAGAGCACTGGAACAACCAGCCACAGGACTACCAAGAGCCACAAAACCACCACTCACAGGACAACCACCACAGGCACCACCAGCCACGGACCCACGACTGCCACTCACAACCCCACCACCACCAGCCATGGAAACGTCACAGTTCATCCAACAAGCAATAGCACTGCCACCAGCCAGGGACCCTCAACTGCCACTCACAGTCCTGCCACCACTAGTCATGGAAATGCCACGGTTCATCCAACAAGCAACAGCACTGCCACCAGCCCAGGATTCACCAGTTCTGCCCACCCAGAACCACCTCCACCCTCTCCGAGTCCTAGCCCAACCTCCAAGGAGACCATTGGAGACTACACGTGGACCAATGGTTCCCAGCCCTGTGTCCACCTCCAAGCCCAGATTCAGATTCGAGTCATGTACACAACCCAGGGTGGAGGAGAGGCCTGGGGCATCTCTGTACTGAACCCCAACAAAACCAAGGTCCAGGGAAGCTGTGAGGGTGCCCATCCCCACCTGCTTCTCTCATTCCCCTATGGACACCTCAGCTTTGGATTCATGCAGGACCTCCAGCAGAAGGTTGTCTACCTGAGCTACATGGCGGTGGAGTACAATGTGTCCTTCCCCCACGCAGCACAGTGGACATTCTCGGCTCAGAATGCATCCCTTCGAGATCTCCAAGCACCCCTGGGGCAGAGCTTCAGTTGCAGCAACTCGAGCATCATTCTTTCACCAGCTGTCCACCTCGACCTGCTCTCCCTGAGGCTCCAGGCTGCTCAGCTGCCCCACACAGGGGTCTTTGGGCAAAGTTTCTCCTGCCCCAGTGACCGGTCCATCTTGCTGCCTCTCATCATCGGCCTGATCCTTCTTGGCCTCCTCGCCCTGGTGCTTATTGCTTTCTGCATCATCCGGAGACGCCCATCCGCCTACCAGGCCCTCTGA
ORF Protein Sequence MRLAVLFSGALLGLLAAQGTGNDCPHKKSATLLPSFTVTPTVTESTGTTSHRTTKSHKTTTHRTTTTGTTSHGPTTATHNPTTTSHGNVTVHPTSNSTATSQGPSTATHSPATTSHGNATVHPTSNSTATSPGFTSSAHPEPPPPSPSPSPTSKETIGDYTWTNGSQPCVHLQAQIQIRVMYTTQGGGEAWGISVLNPNKTKVQGSCEGAHPHLLLSFPYGHLSFGFMQDLQQKVVYLSYMAVEYNVSFPHAAQWTFSAQNASLRDLQAPLGQSFSCSNSSIILSPAVHLDLLSLRLQAAQLPHTGVFGQSFSCPSDRSILLPLIIGLILLGLLALVLIAFCIIRRRPSAYQAL

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-MP0214-Ab Anti-CD68/ GP110/ LAMP4 monoclonal antibody
    Target Antigen GM-Tg-g-MP0214-Ag CD68 VLP (virus-like particle)
    ORF Viral Vector pGMLP004227 Human CD68 Lentivirus plasmid
    ORF Viral Vector pGMLV002519 Human CD68 Lentivirus plasmid
    ORF Viral Vector vGMLP004227 Human CD68 Lentivirus particle
    ORF Viral Vector vGMLV002519 Human CD68 Lentivirus particle


    Target information

    Target ID GM-MP0214
    Target Name CD68
    Gene ID 968, 12514, 715923, 287435, 101099002, 111095877, 504960, 100034045
    Gene Symbol and Synonyms CD68,GP110,LAMP4,SCARD1
    Uniprot Accession P34810
    Uniprot Entry Name CD68_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Not Available
    Disease Cancer
    Gene Ensembl ENSG00000129226
    Target Classification Tumor-associated antigen (TAA)

    This gene encodes a 110-kD transmembrane glycoprotein that is highly expressed by human monocytes and tissue macrophages. It is a member of the lysosomal/endosomal-associated membrane glycoprotein (LAMP) family. The protein primarily localizes to lysosomes and endosomes with a smaller fraction circulating to the cell surface. It is a type I integral membrane protein with a heavily glycosylated extracellular domain and binds to tissue- and organ-specific lectins or selectins. The protein is also a member of the scavenger receptor family. Scavenger receptors typically function to clear cellular debris, promote phagocytosis, and mediate the recruitment and activation of macrophages. Alternative splicing results in multiple transcripts encoding different isoforms. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.