Human CD68/GP110/LAMP4 ORF/cDNA clone-Lentivirus plasmid (NM_001251.3)
Cat. No.: pGMLV002519
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days
Pre-made Human CD68/GP110/LAMP4 Lentiviral expression plasmid for CD68 lentivirus packaging, CD68 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go to
CD68/GP110 products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product Description
| Catalog ID | pGMLV002519 |
| Gene Name | CD68 |
| Accession Number | NM_001251.3 |
| Gene ID | 968 |
| Species | Human |
| Product Type | Lentivirus plasmid (overexpression) |
| Insert Length | 1065 bp |
| Gene Alias | GP110,LAMP4,SCARD1 |
| Fluorescent Reporter | Null |
| Mammalian Cell Selection | Puromyocin |
| Fusion Tag | 3xflag (C-Terminal) |
| Promoter | CMV |
| Resistance | Amplicin |
| ORF Nucleotide Sequence | ATGAGGCTGGCTGTGCTTTTCTCGGGGGCCCTGCTGGGGCTACTGGCAGCCCAGGGGACAGGGAATGACTGTCCTCACAAAAAATCAGCTACTTTGCTGCCATCCTTCACGGTGACACCCACGGTTACAGAGAGCACTGGAACAACCAGCCACAGGACTACCAAGAGCCACAAAACCACCACTCACAGGACAACCACCACAGGCACCACCAGCCACGGACCCACGACTGCCACTCACAACCCCACCACCACCAGCCATGGAAACGTCACAGTTCATCCAACAAGCAATAGCACTGCCACCAGCCAGGGACCCTCAACTGCCACTCACAGTCCTGCCACCACTAGTCATGGAAATGCCACGGTTCATCCAACAAGCAACAGCACTGCCACCAGCCCAGGATTCACCAGTTCTGCCCACCCAGAACCACCTCCACCCTCTCCGAGTCCTAGCCCAACCTCCAAGGAGACCATTGGAGACTACACGTGGACCAATGGTTCCCAGCCCTGTGTCCACCTCCAAGCCCAGATTCAGATTCGAGTCATGTACACAACCCAGGGTGGAGGAGAGGCCTGGGGCATCTCTGTACTGAACCCCAACAAAACCAAGGTCCAGGGAAGCTGTGAGGGTGCCCATCCCCACCTGCTTCTCTCATTCCCCTATGGACACCTCAGCTTTGGATTCATGCAGGACCTCCAGCAGAAGGTTGTCTACCTGAGCTACATGGCGGTGGAGTACAATGTGTCCTTCCCCCACGCAGCACAGTGGACATTCTCGGCTCAGAATGCATCCCTTCGAGATCTCCAAGCACCCCTGGGGCAGAGCTTCAGTTGCAGCAACTCGAGCATCATTCTTTCACCAGCTGTCCACCTCGACCTGCTCTCCCTGAGGCTCCAGGCTGCTCAGCTGCCCCACACAGGGGTCTTTGGGCAAAGTTTCTCCTGCCCCAGTGACCGGTCCATCTTGCTGCCTCTCATCATCGGCCTGATCCTTCTTGGCCTCCTCGCCCTGGTGCTTATTGCTTTCTGCATCATCCGGAGACGCCCATCCGCCTACCAGGCCCTCTGA |
| ORF Protein Sequence | MRLAVLFSGALLGLLAAQGTGNDCPHKKSATLLPSFTVTPTVTESTGTTSHRTTKSHKTTTHRTTTTGTTSHGPTTATHNPTTTSHGNVTVHPTSNSTATSQGPSTATHSPATTSHGNATVHPTSNSTATSPGFTSSAHPEPPPPSPSPSPTSKETIGDYTWTNGSQPCVHLQAQIQIRVMYTTQGGGEAWGISVLNPNKTKVQGSCEGAHPHLLLSFPYGHLSFGFMQDLQQKVVYLSYMAVEYNVSFPHAAQWTFSAQNASLRDLQAPLGQSFSCSNSSIILSPAVHLDLLSLRLQAAQLPHTGVFGQSFSCPSDRSILLPLIIGLILLGLLALVLIAFCIIRRRPSAYQAL |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
| Category | Cat No. | Products Name |
|---|---|---|
| Target Antibody | GM-Tg-g-MP0214-Ab | Anti-CD68/ GP110/ LAMP4 monoclonal antibody |
| Target Antigen | GM-Tg-g-MP0214-Ag | CD68 VLP (virus-like particle) |
| ORF Viral Vector | pGMLP004227 | Human CD68 Lentivirus plasmid |
| ORF Viral Vector | pGMLV002519 | Human CD68 Lentivirus plasmid |
| ORF Viral Vector | vGMLP004227 | Human CD68 Lentivirus particle |
| ORF Viral Vector | vGMLV002519 | Human CD68 Lentivirus particle |
Target information
| Target ID | GM-MP0214 |
| Target Name | CD68 |
| Gene ID | 968, 12514, 715923, 287435, 101099002, 111095877, 504960, 100034045 |
| Gene Symbol and Synonyms | CD68,GP110,LAMP4,SCARD1 |
| Uniprot Accession | P34810 |
| Uniprot Entry Name | CD68_HUMAN |
| Protein Sub-location | Transmembrane Protein |
| Category | Not Available |
| Disease | Cancer |
| Gene Ensembl | ENSG00000129226 |
| Target Classification | Tumor-associated antigen (TAA) |
This gene encodes a 110-kD transmembrane glycoprotein that is highly expressed by human monocytes and tissue macrophages. It is a member of the lysosomal/endosomal-associated membrane glycoprotein (LAMP) family. The protein primarily localizes to lysosomes and endosomes with a smaller fraction circulating to the cell surface. It is a type I integral membrane protein with a heavily glycosylated extracellular domain and binds to tissue- and organ-specific lectins or selectins. The protein is also a member of the scavenger receptor family. Scavenger receptors typically function to clear cellular debris, promote phagocytosis, and mediate the recruitment and activation of macrophages. Alternative splicing results in multiple transcripts encoding different isoforms. [provided by RefSeq, Jul 2008]
About GMVC

GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.


