Human TNNC1/CMD1Z/ CMH13 ORF/cDNA clone-Lentivirus plasmid (NM_003280)

Pre-made Human TNNC1/CMD1Z/ CMH13 Lentiviral expression plasmid for TNNC1 lentivirus packaging, TNNC1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

Target products collectionGo to TN-C/TNNC1/CMD1Z products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMLP004254 Human TNNC1 Lentivirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMLP004254
Gene Name TNNC1
Accession Number NM_003280
Gene ID 7134
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 486 bp
Gene Alias CMD1Z, CMH13, TN-C, TNC, TNNC
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGGATGACATCTACAAGGCTGCGGTAGAGCAGCTGACAGAAGAGCAGAAAAATGAGTTCAAGGCAGCCTTCGACATCTTCGTGCTGGGCGCTGAGGATGGCTGCATCAGCACCAAGGAGCTGGGCAAGGTGATGAGGATGCTGGGCCAGAACCCCACCCCTGAGGAGCTGCAGGAGATGATCGATGAGGTGGACGAGGACGGCAGCGGCACGGTGGACTTTGATGAGTTCCTGGTCATGATGGTTCGGTGCATGAAGGACGACAGCAAAGGGAAATCTGAGGAGGAGCTGTCTGACCTCTTCCGCATGTTTGACAAAAATGCTGATGGCTACATCGACCTGGATGAGCTGAAGATAATGCTGCAGGCTACAGGCGAGACCATCACGGAGGACGACATCGAGGAGCTCATGAAGGACGGAGACAAGAACAACGACGGCCGCATCGACTATGATGAGTTCCTGGAGTTCATGAAGGGTGTGGAGTAG

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T12966-Ab Anti-TN-C monoclonal antibody
    Target Antigen GM-Tg-g-T12966-Ag TN-C/TNNC1 protein
    ORF Viral Vector pGMLP004254 Human TNNC1 Lentivirus plasmid
    ORF Viral Vector vGMLP004254 Human TNNC1 Lentivirus particle


    Target information

    Target ID GM-T12966
    Target Name TN-C
    Gene ID 7134, 21924, 697047, 290561, 101082986, 476595, 509486, 100051811
    Gene Symbol and Synonyms CMD1Z,CMH13,cTnC,cTnI,TN-C,TNC,tncc,TNNC,TNNC1
    Uniprot Accession P63316
    Uniprot Entry Name TNNC1_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target
    Disease Not Available
    Gene Ensembl ENSG00000114854
    Target Classification Not Available

    Troponin is a central regulatory protein of striated muscle contraction, and together with tropomyosin, is located on the actin filament. Troponin consists of 3 subunits: TnI, which is the inhibitor of actomyosin ATPase; TnT, which contains the binding site for tropomyosin; and TnC, the protein encoded by this gene. The binding of calcium to TnC abolishes the inhibitory action of TnI, thus allowing the interaction of actin with myosin, the hydrolysis of ATP, and the generation of tension. Mutations in this gene are associated with cardiomyopathy dilated type 1Z. [provided by RefSeq, Oct 2008]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.