Human TNNC1/CMD1Z/ CMH13 ORF/cDNA clone-Lentivirus particle (NM_003280)
Pre-made Human TNNC1/CMD1Z/ CMH13 Lentiviral expression plasmid for TNNC1 lentivirus packaging, TNNC1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go
to TN-C/TNNC1/CMD1Z products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
---|---|---|---|
vGMLP004254 | Human TNNC1 Lentivirus particle | Pilot Grade | 1.0E+8TU |
5.0E+8TU | |||
1.0E+9TU | |||
Research Grade | 1.0E+8TU | ||
5.0E+8TU | |||
1.0E+9TU | |||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMLP004254 |
Gene Name | TNNC1 |
Accession Number | NM_003280 |
Gene ID | 7134 |
Species | Human |
Product Type | Lentivirus particle (overexpression) |
Insert Length | 486 bp |
Gene Alias | CMD1Z, CMH13, TN-C, TNC, TNNC |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGGATGACATCTACAAGGCTGCGGTAGAGCAGCTGACAGAAGAGCAGAAAAATGAGTTCAAGGCAGCCTTCGACATCTTCGTGCTGGGCGCTGAGGATGGCTGCATCAGCACCAAGGAGCTGGGCAAGGTGATGAGGATGCTGGGCCAGAACCCCACCCCTGAGGAGCTGCAGGAGATGATCGATGAGGTGGACGAGGACGGCAGCGGCACGGTGGACTTTGATGAGTTCCTGGTCATGATGGTTCGGTGCATGAAGGACGACAGCAAAGGGAAATCTGAGGAGGAGCTGTCTGACCTCTTCCGCATGTTTGACAAAAATGCTGATGGCTACATCGACCTGGATGAGCTGAAGATAATGCTGCAGGCTACAGGCGAGACCATCACGGAGGACGACATCGAGGAGCTCATGAAGGACGGAGACAAGAACAACGACGGCCGCATCGACTATGATGAGTTCCTGGAGTTCATGAAGGGTGTGGAGTAG |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T12966-Ab | Anti-TN-C monoclonal antibody |
Target Antigen | GM-Tg-g-T12966-Ag | TN-C/TNNC1 protein |
ORF Viral Vector | pGMLP004254 | Human TNNC1 Lentivirus plasmid |
ORF Viral Vector | vGMLP004254 | Human TNNC1 Lentivirus particle |
Target information
Target ID | GM-T12966 |
Target Name | TN-C |
Gene ID | 7134, 21924, 697047, 290561, 101082986, 476595, 509486, 100051811 |
Gene Symbol and Synonyms | CMD1Z,CMH13,cTnC,cTnI,TN-C,TNC,tncc,TNNC,TNNC1 |
Uniprot Accession | P63316 |
Uniprot Entry Name | TNNC1_HUMAN |
Protein Sub-location | Introcelluar Protein |
Category | Therapeutics Target |
Disease | Not Available |
Gene Ensembl | ENSG00000114854 |
Target Classification | Not Available |
Troponin is a central regulatory protein of striated muscle contraction, and together with tropomyosin, is located on the actin filament. Troponin consists of 3 subunits: TnI, which is the inhibitor of actomyosin ATPase; TnT, which contains the binding site for tropomyosin; and TnC, the protein encoded by this gene. The binding of calcium to TnC abolishes the inhibitory action of TnI, thus allowing the interaction of actin with myosin, the hydrolysis of ATP, and the generation of tension. Mutations in this gene are associated with cardiomyopathy dilated type 1Z. [provided by RefSeq, Oct 2008]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.