Human P2RY4/NRU/P2P ORF/cDNA clone-Lentivirus plasmid (NM_002565)

Cat. No.: pGMLP004267
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human P2RY4/NRU/P2P Lentiviral expression plasmid for P2RY4 lentivirus packaging, P2RY4 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

pdf Datasheet
pdf MSDS
pdf Terms of Use
Target products collection

Go to P2RY4/NRU products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $607.44
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP004267
Gene Name P2RY4
Accession Number NM_002565
Gene ID 5030
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 1098 bp
Gene Alias NRU,P2P,P2Y4,UNR
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGCCAGTACAGAGTCCTCCCTGTTGAGATCCCTAGGCCTCAGCCCAGGTCCTGGCAGCAGTGAGGTGGAGCTGGACTGTTGGTTTGATGAGGATTTCAAGTTCATCCTGCTGCCTGTGAGCTATGCAGTTGTCTTTGTGCTGGGCTTGGGCCTTAACGCCCCAACCCTATGGCTCTTCATCTTCCGCCTCCGACCCTGGGATGCAACGGCCACCTACATGTTCCACCTGGCATTGTCAGACACCTTGTATGTGCTGTCGCTGCCCACCCTCATCTACTATTATGCAGCCCACAACCACTGGCCCTTTGGCACTGAGATCTGCAAGTTCGTCCGCTTTCTTTTCTATTGGAACCTCTACTGCAGTGTCCTTTTCCTCACCTGCATCAGCGTGCACCGCTACCTGGGCATCTGCCACCCACTTCGGGCACTACGCTGGGGCCGCCCTCGCCTCGCAGGCCTTCTCTGCCTGGCAGTTTGGTTGGTCGTAGCCGGCTGCCTCGTGCCCAACCTGTTCTTTGTCACAACCAGCAACAAAGGGACCACCGTCCTGTGCCATGACACCACTCGGCCTGAAGAGTTTGACCACTATGTGCACTTCAGCTCGGCGGTCATGGGGCTGCTCTTTGGCGTGCCCTGCCTGGTCACTCTTGTTTGCTATGGACTCATGGCTCGTCGCCTGTATCAGCCCTTGCCAGGCTCTGCACAGTCGTCTTCTCGCCTCCGCTCTCTCCGCACCATAGCTGTGGTGCTGACTGTCTTTGCTGTCTGCTTCGTGCCTTTCCACATCACCCGCACCATTTACTACCTGGCCAGGCTGTTGGAAGCTGACTGCCGAGTACTGAACATTGTCAACGTGGTCTATAAAGTGACTCGGCCCCTGGCCAGTGCCAACAGCTGCCTGGATCCTGTGCTCTACTTGCTCACTGGGGACAAATATCGACGTCAGCTCCGTCAGCTCTGTGGTGGTGGCAAGCCCCAGCCCCGCACGGCTGCCTCTTCCCTGGCACTAGTGTCCCTGCCTGAGGATAGCAGCTGCAGGTGGGCGGCCACCCCCCAGGACAGTAGCTGCTCTACTCCTAGGGCAGATAGATTGTAA
ORF Protein Sequence MASTESSLLRSLGLSPGPGSSEVELDCWFDEDFKFILLPVSYAVVFVLGLGLNAPTLWLFIFRLRPWDATATYMFHLALSDTLYVLSLPTLIYYYAAHNHWPFGTEICKFVRFLFYWNLYCSVLFLTCISVHRYLGICHPLRALRWGRPRLAGLLCLAVWLVVAGCLVPNLFFVTTSNKGTTVLCHDTTRPEEFDHYVHFSSAVMGLLFGVPCLVTLVCYGLMARRLYQPLPGSAQSSSRLRSLRTIAVVLTVFAVCFVPFHITRTIYYLARLLEADCRVLNIVNVVYKVTRPLASANSCLDPVLYLLTGDKYRRQLRQLCGGGKPQPRTAASSLALVSLPEDSSCRWAATPQDSSCSTPRADRL

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T82083-Ab Anti-P2RY4/ NRU/ P2P monoclonal antibody
    Target Antigen GM-Tg-g-T82083-Ag P2RY4 VLP (virus-like particle)
    ORF Viral Vector pGMLP004267 Human P2RY4 Lentivirus plasmid
    ORF Viral Vector vGMLP004267 Human P2RY4 Lentivirus particle


    Target information

    Target ID GM-T82083
    Target Name P2RY4
    Gene ID 5030, 57385, 695127, 63843, 101087905, 100688008, 514653, 111771529
    Gene Symbol and Synonyms NRU,P2P,P2RY4,P2Y4,P2Y4R,UNR
    Uniprot Accession P51582
    Uniprot Entry Name P2RY4_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target
    Disease Not Available
    Gene Ensembl ENSG00000186912
    Target Classification GPCR

    The product of this gene belongs to the family of G-protein coupled receptors. This family has several receptor subtypes with different pharmacological selectivity, which overlaps in some cases, for various adenosine and uridine nucleotides. This receptor is responsive to uridine nucleotides, partially responsive to ATP, and not responsive to ADP. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.